image of the BVTech Plasmid

Bacterial Plasmids


pET_11_a to pET_DEST42_Gateway | pET100_Directional_TOPO to pET-11_a | pET11a to pET12a | pET12b to pET-15b | pET-16b to pET200_Directional_TOPO | pET-20b(+) to pET-21_c_(+) | pET-21_d_(+) to pET-24(+) | pET-24_a_(+) to pET-25b(+) | pET-26b(+) to pET-28_c_(+) | pET-29_a_(+) to pET-3_b | pET-3_c to pET-30_c_(+) | pET-30_Ek_LIC to pET-32_Ek_LIC | pET-32_Xa_LIC to pET-3b | pET-3c to pET-41_b(+) | pET-41_c(+) to pET-42_c(+) | pET-43.1_a_(+) to pET-44_a(+) | pET-44_b(+) to pET-48b(+) | pET-49b(+) to pET9b | pET-9b to pET-9d | pETBlue-1 to pGEM-T_Easy_Vector | pGEM-T_vector to pGEX-5X-1 | pGEX-5X-2 to pGEX-6P-3 | pGP704 to pHSV-106 | pHY300PLK to PinPoint_Xa-1_T-Vector | PinPoint_Xa-2 to pKH80 | pKJB1 to pKK216-1 | pKK223-3 to pKK353-5 | pKK388-1 to pKK9-4 | 

All plasmid maps listed here are created using BVTech Plasmid. If you do not have BVTech Plasmid, Click here to download the latest version of BVTech Plasmid

BVTech Plasmid is DNA sequence analysis and plasmid drawing software for Windows PCs.You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your DNA sequencing data, align sequences, and much more.

Free to try, $39.98 to buy

Payments will be processed by PayPal. PayPal is the safer, easier way to pay.

Plasmids 0 - 4Descriptions
small image of pET_11_apET 11 a - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Bacteria Resistance: Ampicillin; Catalog Number: 69436-3, 69437-3, 69438-3, 69439-3; Comments:A,b,c,d vary by MCS
small image of pET_11_bpET 11 b - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: 5'd[TAATACGACTCACTATAGGG; Bacteria Resistance: Ampicillin; Catalog Number: 69436-3, 69437-3, 69438-3, 69439-3
small image of pET_11_cpET 11 c - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Bacteria Resistance: Ampicillin; Catalog Number: 69436-3, 69437-3, 69438-3, 69439-3; Comments:A,b,c,d vary by MCS
small image of pET_11_dpET 11 d - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Bacteria Resistance: Ampicillin; Catalog Number: 69436-3, 69437-3, 69438-3, 69439-3; Comments:A,b,c,d vary by MCS
small image of pET_DEST42_GatewaypET DEST42 Gateway - Vendor:Invitrogen; Vector Type: Bacterial; Promoter: n/a; Expression Level: Tightly controlled (use w/ BL21-AI); Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His (Cterm), V5; Bacteria Resistance: Ampicillin; Mammalian Selection: N/a; Catalog Number: 12276010; Comments:Easy to clone into other vectors

Plasmids 5 - 9Descriptions
small image of pET100_Directional_TOPOpET100 Directional TOPO - Vendor:Invitrogen; Vector Type: Bacterial; Promoter: n/a; Expression Level: Tightly controlled (use w/ BL21-AI); Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His (Nterm); Bacteria Resistance: Ampicillin; Mammalian Selection: N/a; Catalog Number: K10001
small image of pET101_Directional_TOPOpET101 Directional TOPO - Vendor:Invitrogen; Vector Type: Bacterial; Promoter: n/a; Expression Level: High (use w/ BL21DE3); Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His (Cterm), V5; Bacteria Resistance: Ampicillin; Mammalian Selection: N/a; Catalog Number: K10101
small image of pET102_Directional_TOPOpET102 Directional TOPO - Vendor:Invitrogen; Vector Type: Bacterial; Promoter: n/a; Expression Level: Tightly controlled (use w/ BL21-AI); Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Bacteria Resistance: Ampicillin; Mammalian Selection: N/a; Catalog Number: K10201
small image of pET104.1_DESTpET104.1 DEST - Vendor:Invitrogen; Vector Type: Bacterial; Promoter: n/a; Expression Level: Tightly controlled (use w/ BL21-AI); Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: biotin (Nterm); Bacteria Resistance: Ampicillin; Mammalian Selection: N/a; Catalog Number: K104-01; Comments:Easy to clone into other vectors
small image of pET-11_apET-11 a - Vendor:Stratagene; Vector Type: Bacterial; Promoter: T7/lacO; Expression Level: Tightly controlled (use IPTG to activate); Sequencing Primer: T7 Fwd; Bacteria Resistance: Ampicillin; Catalog Number: 211523; Comments:Tighter control of expression level than pET-3; a,b,c,d vary by MCS

Plasmids 10 - 14Descriptions
small image of pET11apET11a - Vendor:New England Biolabs; Comments:Approximate size is 5675 bp. Hosts: E.coli. Related vectors: pBR322. (Information source: VectorDB.)
small image of pET11bpET11b - Vendor:New England Biolabs; Comments:Approximate size is 5675 bp. Hosts: E.coli. Related vectors: pBR322. (Information source: VectorDB.)
small image of pET11cpET11c - Vendor:New England Biolabs; Comments:Approximate size is 5675 bp. Hosts: E.coli. Related vectors: pBR322. (Information source: VectorDB.)
small image of pET11dpET11d - Vendor:New England Biolabs; Comments:Approximate size is 5675 bp. Hosts: E.coli. Related vectors: pBR322. (Information source: VectorDB.)
small image of pET12apET12a - Vendor:New England Biolabs; Comments:Hosts: E.coli. Related vectors: pBR322. (Information source: VectorDB.)

Plasmids 15 - 19Descriptions
small image of pET12bpET12b - Vendor:New England Biolabs; Comments:Hosts: E.coli. Related vectors: pBR322. (Information source: VectorDB.)
small image of pET12cpET12c - Vendor:New England Biolabs; Comments:Hosts: E.coli. Related vectors: pBR322. (Information source: VectorDB.)
small image of pET-14bpET-14b - Vendor:EMD Biosciences; Alternate Vector Names: pET14b; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Nterm); Bacteria Resistance: Ampicillin; Catalog Number: 69660-3; Comments:Nterm thrombin cleavage site; no lac
small image of pET151_Directional_TOPOpET151 Directional TOPO - Vendor:Invitrogen; Vector Type: Bacterial; Promoter: n/a; Expression Level: Tightly controlled (use w/ BL21-AI); Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His (Nterm), V5; Bacteria Resistance: Ampicillin; Mammalian Selection: N/a; Catalog Number: K15101
small image of pET-15bpET-15b - Vendor:EMD Biosciences; Alternate Vector Names: pET15b; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Nterm); Bacteria Resistance: Ampicillin; Catalog Number: 69661-3; Comments:Nterm thrombin cleavage site

Plasmids 20 - 24Descriptions
small image of pET-16bpET-16b - Vendor:EMD Biosciences; Alternate Vector Names: pET16b; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Nterm); Bacteria Resistance: Ampicillin; Catalog Number: 69662-3; Comments:Nterm Factor Xa cleavage site
small image of pET-17bpET-17b - Vendor:EMD Biosciences; Alternate Vector Names: pET17b; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Bacteria Resistance: Ampicillin; Catalog Number: 69663-3; Comments:Dual BstXI site in MCS
small image of pET-17xbpET-17xb - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Bacteria Resistance: Ampicillin; Catalog Number: 69664-3; Comments:T7 gene 10 coding sequence
small image of pET-19bpET-19b - Vendor:EMD Biosciences; Alternate Vector Names: pET19b; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Nterm); Bacteria Resistance: Ampicillin; Catalog Number: 69677-3
small image of pET200_Directional_TOPOpET200 Directional TOPO - Vendor:Invitrogen; Vector Type: Bacterial; Promoter: n/a; Expression Level: Tightly controlled (use w/ BL21-AI); Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His (Nterm); Bacteria Resistance: Kanamycin; Mammalian Selection: N/a; Catalog Number: K20001

Plasmids 25 - 29Descriptions
small image of pET-20b(+)pET-20b(+) - Vendor:EMD Biosciences; Alternate Vector Names: pET20b; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Cterm); Bacteria Resistance: Ampicillin; Catalog Number: 69739-3
small image of pET-21(+)pET-21(+) - Vendor:EMD Biosciences; Alternate Vector Names: pET21; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Bacteria Resistance: Ampicillin; Catalog Number: 69770-3; Comments:Designed for expression from bacterial translationa...
small image of pET-21_a_(+)pET-21 a (+) - Vendor:EMD Biosciences; Alternate Vector Names: pET21a; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: T7 (Nterm), His (Cterm); Bacteria Resistance: Ampicillin; Catalog Number: 69740-3; Comments:Same as pET24a...
small image of pET-21_b_(+)pET-21 b (+) - Vendor:EMD Biosciences; Alternate Vector Names: pET21b; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: T7 (Nterm), His (Cterm); Bacteria Resistance: Ampicillin; Catalog Number: 69741-3; Comments:Same as pET24a...
small image of pET-21_c_(+)pET-21 c (+) - Vendor:EMD Biosciences; Alternate Vector Names: pET21c; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: T7 (Nterm), His (Cterm); Bacteria Resistance: Ampicillin; Catalog Number: 69742-3; Comments:Same as pET24a...

Plasmids 30 - 34Descriptions
small image of pET-21_d_(+)pET-21 d (+) - Vendor:EMD Biosciences; Alternate Vector Names: pET21d; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: 5'd[TAATACGACTCACTATAGGG]3'; Tag: T7 (Nterm), His (Cterm); Bacteria Resistance: Ampicillin; Catalog Number: 69743-3; Comments:Same as pET24abcd(+) but ampR; a,b,c,d vary by MCS...
small image of pET-22b(+)pET-22b(+) - Vendor:EMD Biosciences; Alternate Vector Names: pET22b; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Cterm); Bacteria Resistance: Ampicillin; Catalog Number: 69744-3; Comments:PelB sequence for periplasmic ...
small image of pET-23(+)pET-23(+) - Vendor:EMD Biosciences; Alternate Vector Names: pET23; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Bacteria Resistance: Ampicillin; Catalog Number: 69771-3; Comments:Designed for expression from bacterial translationa...
small image of pET-23_a_b_c_d(+)pET-23 a,b,c,d(+) - Vendor:Novagen/EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Cterm); Bacteria Resistance: Ampicillin; Catalog Number: 69745-3, 69746-3, 69747-3, 69748-3; Comments:Same as pET21...
small image of pET-24(+)pET-24(+) - Vendor:EMD Biosciences; Alternate Vector Names: pET24; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Bacteria Resistance: Ampicillin; Catalog Number: 69772-3; Comments:Designed for expression from bacterial translationa...

Plasmids 35 - 39Descriptions
small image of pET-24_a_(+)pET-24 a (+) - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: T7 (Nterm), His (Cterm); Bacteria Resistance: Kanamycin; Catalog Number: 69749-3; Comments:Same as pET21abcd(+) but kanR; a,b,c,d vary by ...
small image of pET-24_b_(+)pET-24 b (+) - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: T7 (Nterm), His (Cterm); Mammalian Selection: Kanamycin; Catalog Number: 69750-3; Comments:Same as pET21abcd(+) but kanR; a,b,c,d vary by ...
small image of pET-24_c_(+)pET-24 c (+) - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: T7 (Nterm), His (Cterm); Bacteria Resistance: Kanamycin; Catalog Number: 69751-3; Comments:Same as pET21abcd(+) but kanR; a,b,c,d vary by ...
small image of pET-24_d_(+)pET-24 d (+) - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitiutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: T7 (Nterm), His (Cterm); Bacteria Resistance: Kanamycin; Catalog Number: 69752-3; Comments:Same as pET21abcd(+) but kanR; a,b,c,d vary by...
small image of pET-25b(+)pET-25b(+) - Vendor:EMD Biosciences; Alternate Vector Names: pET25b; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Cterm), HSV (Cterm); Bacteria Resistance: Ampicillin; Catalog Number: 69753-3; Comments:PelB sequence for...

Plasmids 40 - 44Descriptions
small image of pET-26b(+)pET-26b(+) - Vendor:EMD Biosciences; Alternate Vector Names: pET26b; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Cterm); Bacteria Resistance: Kanamycin; Catalog Number: 69862-3; Comments:PelB sequence for periplasmic l...
small image of pET-27b(+)pET-27b(+) - Vendor:EMD Biosciences; Alternate Vector Names: pET27b; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Cterm), HSV (Cterm); Bacteria Resistance: Kanamycin; Catalog Number: 69863-3; Comments:PelB sequence for ...
small image of pET-28_a_(+)pET-28 a (+) - Vendor:EMD Biosciences; Alternate Vector Names: pET28a; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Nterm and Cterm); Bacteria Resistance: Kanamycin; Catalog Number: 69864-3; Comments:Nterm thrombin cl...
small image of pET-28_b_(+)pET-28 b (+) - Vendor:EMD Biosciences; Alternate Vector Names: pET28b; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Nterm and Cterm); Bacteria Resistance: Kanamycin; Catalog Number: 69865-3; Comments:Nterm thrombin cl...
small image of pET-28_c_(+)pET-28 c (+) - Vendor:EMD Biosciences; Alternate Vector Names: pET28c; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Nterm and Cterm); Bacteria Resistance: Kanamycin; Catalog Number: 69866-3; Comments:Nterm thrombin cl...

Plasmids 45 - 49Descriptions
small image of pET-29_a_(+)pET-29 a (+) - Vendor:EMD Biosciences; Alternate Vector Names: pET29a; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Cterm), S-tag (Nterm); Bacteria Resistance: Kanamycin; Catalog Number: 69871-3; Comments:Nterm thromb...
small image of pET-29_b_(+)pET-29 b (+) - Vendor:EMD Biosciences; Alternate Vector Names: pET29b; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Cterm), S-tag (Nterm); Bacteria Resistance: Kanamycin; Catalog Number: 69872-3; Comments:Nterm thromb...
small image of pET-29_c_(+)pET-29 c (+) - Vendor:EMD Biosciences; Alternate Vector Names: pET29c; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Cterm), S-tag (Nterm); Bacteria Resistance: Kanamycin; Catalog Number: 69873-3; Comments:Nterm thromb...
small image of pET-3_apET-3 a - Vendor:Stratagene; Vector Type: Bacterial; Promoter: T7; Expression Level: High; Sequencing Primer: T7 Fwd; Bacteria Resistance: Ampicillin; Catalog Number: 211521; Comments:A,b,c,d vary by MCS
small image of pET-3_bpET-3 b - Vendor:Stratagene; Vector Type: Bacterial; Promoter: T7; Expression Level: High; Sequencing Primer: T7 Fwd; Bacteria Resistance: Ampicillin; Catalog Number: 211521; Comments:A,b,c,d vary by MCS

Plasmids 50 - 54Descriptions
small image of pET-3_cpET-3 c - Vendor:Stratagene; Vector Type: Bacterial; Promoter: T7; Expression Level: High; Sequencing Primer: T7 Fwd; Bacteria Resistance: Ampicillin; Catalog Number: 211521; Comments:A,b,c,d vary by MCS
small image of pET-3_dpET-3 d - Vendor:Stratagene; Vector Type: Bacterial; Promoter: T7; Expression Level: High; Sequencing Primer: T7 Fwd; Bacteria Resistance: Ampicillin; Catalog Number: 211521; Comments:A,b,c,d vary by MCS
small image of pET-30_a_(+)pET-30 a (+) - Vendor:EMD Biosciences; Alternate Vector Names: pET30a; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Nterm and Cterm); Bacteria Resistance: Kanamycin; Catalog Number: 69909-3, 69910-3, 69911-3; Comments...
small image of pET-30_b_(+)pET-30 b (+) - Vendor:EMD Biosciences; Alternate Vector Names: pET30b; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Nterm and Cterm); Bacteria Resistance: Kanamycin; Catalog Number: 69909-3, 69910-3, 69911-3; Comments...
small image of pET-30_c_(+)pET-30 c (+) - Vendor:EMD Biosciences; Alternate Vector Names: pET30c; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Nterm and Cterm); Bacteria Resistance: Kanamycin; Catalog Number: 69909-3, 69910-3, 69911-3; Comments...

Plasmids 55 - 59Descriptions
small image of pET-30_Ek_LICpET-30 Ek/LIC - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Nterm and Cterm), S-Tag (Cterm); Bacteria Resistance: Ampicillin; Catalog Number: 69077-3 (kit); Comments:For directional cloning o...
small image of pET-30_Xa_LICpET-30 Xa/LIC - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Nterm and Cterm), S-Tag (Cterm); Bacteria Resistance: Ampicillin; Catalog Number: 69073-3 (kit); Comments:For directional cloning o...
small image of pET-31b(+)pET-31b(+) - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Cterm); Bacteria Resistance: Ampicillin; Catalog Number: 69952-3; Comments:Fuse with ketosteroid isomerase for high yield bioproduction o...
small image of pET-32_a_b_c(+)pET-32 a,b,c(+) - Vendor:EMD Biosciences; Alternate Vector Names: pET32a, pET32b, pET32c; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: thioredoxin (Nterm); His (internal and Cterm); Bacteria Resistance: Ampicillin; Cata...
small image of pET-32_Ek_LICpET-32 Ek/LIC - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Nterm and Cterm), Trx (Nterm); Bacteria Resistance: Ampicillin; Catalog Number: 69076-3 (kit); Comments:For directional cloning of ...

Plasmids 60 - 64Descriptions
small image of pET-32_Xa_LICpET-32 Xa/LIC - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Nterm and Cterm), Trx (Nterm); Bacteria Resistance: Ampicillin; Catalog Number: 69072-3 (kit); Comments:For directional cloning of ...
small image of pET-33b(+)pET-33b(+) - Vendor:EMD Biosciences; Alternate Vector Names: pET33; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Nterm and Cterm); Bacteria Resistance: Kanamycin; Catalog Number: 69054-3; Comments:Production of target p...
small image of pET-39b(+)pET-39b(+) - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: DsbA, His (Nterm and Cterm), S-Tag (Cterm); Bacteria Resistance: Kanamycin; Catalog Number: 70090-3; Comments:Encodes Dsb tag for export and p...
small image of pET-3apET-3a - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Bacteria Resistance: Ampicillin; Catalog Number: 69418-3, 69419-3, 69420-3, 69421-3; Comments:Same as pET9 but ampR; a,b,c,d vary by MCS
small image of pET-3bpET-3b - Vendor:EMD Biosciences; Vector Type: Bacterial; Sequencing Primer: T7 Fwd; Bacteria Resistance: Ampicillin

Plasmids 65 - 69Descriptions
small image of pET-3cpET-3c - Vendor:EMD Biosciences; Vector Type: Bacterial; Sequencing Primer: T7; Bacteria Resistance: Ampicillin
small image of pET-3dpET-3d - Vendor:EMD Biosciences; Vector Type: Bacterial; Sequencing Primer: T7; Bacteria Resistance: Ampicillin
small image of pET-40b(+)pET-40b(+) - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: DsbC, His (Nterm and Cterm), S-Tag (Cterm); Bacteria Resistance: Kanamycin; Catalog Number: 70091-3; Comments:Encodes Dsb tag for export and p...
small image of pET-41_a(+)pET-41 a(+) - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: GST (Nterm), His (Nterm and Cterm); Bacteria Resistance: Kanamycin; Catalog Number: 70556-3, 70557-3, 70558-3; Comments:Encodes GST fusion t...
small image of pET-41_b(+)pET-41 b(+) - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG; Tag: GST (Nterm), His (Nterm and Cterm); Mammalian Selection: Kanamycin; Catalog Number: 70556-3, 70557-3, 70558-3; Comments:Encodes GST fusion tag;...

Plasmids 70 - 74Descriptions
small image of pET-41_c(+)pET-41 c(+) - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: GST (Nterm), His (Nterm and Cterm); Bacteria Resistance: Kanamycin; Catalog Number: 70556-3, 70557-3, 70558-3; Comments:Encodes GST fusion t...
small image of pET-41_Ek_LICpET-41 Ek/LIC - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: GST (Nterm), His (Nterm), S-Tag (Cterm); Bacteria Resistance: Kanamycin; Catalog Number: 71071-3 (kit); Comments:For directional cloning...
small image of pET-42_a(+)pET-42 a(+) - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: GST (Nterm), His (Nterm and Cterm); Bacteria Resistance: Kanamycin; Catalog Number: 70561-3, 70562-3, 70563-3; Comments:Encodes GST fusion t...
small image of pET-42_b(+)pET-42 b(+) - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: GST (Nterm), His (Nterm and Cterm); Bacteria Resistance: Kanamycin; Catalog Number: 70561-3, 70562-3, 70563-3; Comments:Encodes GST fusion t...
small image of pET-42_c(+)pET-42 c(+) - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transcient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: GST (Nterm), His (Nterm and Cterm); Bacteria Resistance: Kanamycin; Catalog Number: 70561-3, 70562-3, 70563-3; Comments:Encodes GST fusion ...

Plasmids 75 - 79Descriptions
small image of pET-43.1_a_(+)pET-43.1 a (+) - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Nterm and Cterm), HSV (Nterm); Bacteria Resistance: Ampicillin; Catalog Number: 70939-3, 70940-3, 70941-3; Comments:Cterm His tag...
small image of pET-43.1_b_(+)pET-43.1 b (+) - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Nterm and Cterm), HSV (Nterm); Bacteria Resistance: Ampicillin; Catalog Number: 70939-3, 70940-3, 70941-3; Comments:Cterm His tag...
small image of pET-43.1_c_(+)pET-43.1 c (+) - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Nterm and Cterm), HSV (Nterm); Bacteria Resistance: Ampicillin; Catalog Number: 70939-3, 70940-3, 70941-3; Comments:Cterm His tag...
small image of pET-43.1_Ek_LICpET-43.1 Ek/LIC - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: HSV (Nterm), His (Nterm), Nus (Nterm), S-Tag (Nterm); Bacteria Resistance: Ampicillin; Catalog Number: 71072-3 (kit); Comments:For d...
small image of pET-44_a(+)pET-44 a(+) - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Nterm and Cterm), HSV (Nterm); Bacteria Resistance: Ampicillin; Catalog Number: 71122-3, 71123-3, 71124-3,; Comments:Both Nterm and Cte...

Plasmids 80 - 84Descriptions
small image of pET-44_b(+)pET-44 b(+) - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Nterm and Cterm), HSV (Nterm); Bacteria Resistance: Ampicillin; Catalog Number: 71122-3, 71123-3, 71124-3,; Comments:Both Nterm and Cte...
small image of pET-44_c(+)pET-44 c(+) - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Nterm and Cterm), HSV (Nterm); Bacteria Resistance: Ampicillin; Catalog Number: 71122-3, 71123-3, 71124-3,; Comments:Both Nterm and Cte...
small image of pET-44_Ek_LICpET-44 Ek/LIC - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Nterm), S-Tag (Cterm); Bacteria Resistance: Ampicillin; Catalog Number: 71335-3 (kit); Comments:For directional cloning of PCR-ampl...
small image of pET-47b(+)pET-47b(+) - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Nterm), S-Tag (Cterm); Bacteria Resistance: Kanamycin; Catalog Number: 71461-3; Comments:Contains HRV 3C Protease cleavage site for fusio...
small image of pET-48b(+)pET-48b(+) - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: GST (Nterm), His (Nterm), S-Tag (Cterm); Bacteria Resistance: Kanamycin; Catalog Number: 71462-3; Comments:Same as pET47 but also has Nterm Tr...

Plasmids 85 - 89Descriptions
small image of pET-49b(+)pET-49b(+) - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: Trx (Nterm), His (Nterm), S-Tag (Cterm); Bacteria Resistance: Kanamycin; Catalog Number: 71463-3; Comments:Same as pET47 but also has Nterm GS...
small image of pET-50b(+)pET-50b(+) - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: Nus (Nterm), His (Nterm), S-Tag (Cterm); Bacteria Resistance: Kanamycin; Catalog Number: 71464-3; Comments:Same as pET47 but also has Nterm Nu...
small image of pET9apET9a - Vendor:New England Biolabs; Comments:Hosts: E.coli. Related vectors: pBR322. (Information source: VectorDB.)
small image of pET-9apET-9a - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Bacteria Resistance: Kanamycin; Comments:Same as pET3 but kanR; a,b,c,d vary by MCS
small image of pET9bpET9b - Vendor:New England Biolabs; Comments:Hosts: E.coli. Related vectors: pBR322. (Information source: VectorDB.)

Plasmids 90 - 94Descriptions
small image of pET-9bpET-9b - Vendor:EMD Biosciences; Sequencing Primer: T7; Bacteria Resistance: Kanamycin
small image of pET9cpET9c - Vendor:New England Biolabs; Comments:Hosts: E.coli. Related vectors: pBR322. (Information source: VectorDB.)
small image of pET-9cpET-9c - Vendor:EMD Biosciences; Sequencing Primer: T7; Bacteria Resistance: Ampicillin
small image of pET9dpET9d - Vendor:New England Biolabs; Comments:Hosts: E.coli. Related vectors: pBR322. (Information source: VectorDB.)
small image of pET-9dpET-9d - Vendor:EMD Biosciences; Sequencing Primer: T7; Bacteria Resistance: Ampicillin

Plasmids 95 - 99Descriptions
small image of pETBlue-1pETBlue-1 - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Bacteria Resistance: Ampicillin; Comments:Blue/white identification; unique MCS
small image of pETBlue-2pETBlue-2 - Vendor:EMD Biosciences; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Cterm), HSV (Cterm); Bacteria Resistance: Ampicillin; Comments:Blue/white identification; unique MCS; His and HSV tagged
small image of pEYFPpEYFP - Vendor:Clontech; Vector Type: Bacterial; Promoter: lac; Sequencing Primer: EGFP-N; Sequencing Primer Sequence: 5'd[CGTCGCCGTCCAGCTCGACCAG]3'; Tag: ECFP; Bacteria Resistance: Ampicillin; Catalog Number: 6004-1; Comments:Yellow variant of GFP tag
small image of pGEM-13Zf(+)pGEM-13Zf(+) - Vendor:Promega; Alternate Vector Names: pGEM13, pGEM13Zf; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: no tag; Bacteria Resistance: Ampicillin; Mammalian Selection: N/a; Catalog Number: P2541; GenBank Access...
small image of pGEM-T_Easy_VectorpGEM-T Easy Vector - Vendor:Promega; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7, SP6, M13Fwd or M13Rev; Bacteria Resistance: Ampicillin; Catalog Number: A1360; Comments:The only difference between pGEM-T and pGEM-T Easy is in the multiple cloning site (MCS). The MCS of the pGEM-T ...

Plasmids 100 - 104Descriptions
small image of pGEM-T_vectorpGEM-T vector - Vendor:Promega; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7, SP6, M13Fwd or M13Rev; Bacteria Resistance: Ampicillin; Catalog Number: A3600; Comments:Cloning PCR products; also see pGEM-T Easy
small image of pGEX-4T-1pGEX-4T-1 - Vendor:Amersham; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: tac; Expression Level: High (activate with IPTG); Sequencing Primer: pGEX Fwd; Sequencing Primer Sequence: 5'd[GGGCTGGCAAGCCACGTTTGGTG]3'; Tag: GST (Nterm); Bacteria Resistance: Ampicillin; Mammalian Selection: N/a; Catalog Number: 27-4580-01; Comments:T...
small image of pGEX-4T-2pGEX-4T-2 - Vendor:Amersham; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: tac; Expression Level: High (activate with IPTG); Sequencing Primer: pGEX Fwd; Sequencing Primer Sequence: 5'd[GGGCTGGCAAGCCACGTTTGGTG]3'; Tag: GST (Nterm); Bacteria Resistance: Ampicillin; Mammalian Selection: N/a; Catalog Number: 27-4581-01; Comments:T...
small image of pGEX-4T-3pGEX-4T-3 - Vendor:Amersham; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: tac; Expression Level: High (activate with IPTG); Sequencing Primer: pGEX Fwd; Sequencing Primer Sequence: 5'd[GGGCTGGCAAGCCACGTTTGGTG]3'; Tag: GST (Nterm); Bacteria Resistance: Ampicillin; Mammalian Selection: N/a; Catalog Number: 27-4583-01; Comments:T...
small image of pGEX-5X-1pGEX-5X-1 - Vendor:Amersham; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: tac; Expression Level: High (activate with IPTG); Sequencing Primer: pGEX Fwd; Sequencing Primer Sequence: 5'd[GGGCTGGCAAGCCACGTTTGGTG]3'; Tag: GST (Nterm); Bacteria Resistance: Ampicillin; Mammalian Selection: N/a; Catalog Number: 27-4584-01; Comments:F...

Plasmids 105 - 109Descriptions
small image of pGEX-5X-2pGEX-5X-2 - Vendor:Amersham; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: tac; Expression Level: High (activate with IPTG); Sequencing Primer: pGEX Fwd; Sequencing Primer Sequence: 5'd[GGGCTGGCAAGCCACGTTTGGTG]3'; Tag: GST (Nterm); Bacteria Resistance: Ampicillin; Mammalian Selection: N/a; Catalog Number: 27-4585-01; Comments:F...
small image of pGEX-5X-3pGEX-5X-3 - Vendor:Amersham; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: tac; Expression Level: High (activate with IPTG); Sequencing Primer: pGEX Fwd; Sequencing Primer Sequence: 5'd[GGGCTGGCAAGCCACGTTTGGTG]3'; Tag: GST (Nterm); Bacteria Resistance: Ampicillin; Mammalian Selection: N/a; Catalog Number: 27-4586-01; Comments:F...
small image of pGEX-6P-1pGEX-6P-1 - Vendor:Amersham; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: tac; Expression Level: High (activate with IPTG); Sequencing Primer: pGEX Fwd; Sequencing Primer Sequence: 5'd[GGGCTGGCAAGCCACGTTTGGTG]3'; Tag: GST (Nterm); Bacteria Resistance: Ampicillin; Mammalian Selection: N/a; Catalog Number: 27-4597-01; Comments:P...
small image of pGEX-6P-2pGEX-6P-2 - Vendor:Amersham; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: tac; Expression Level: High (activate with IPTG); Sequencing Primer: pGEX Fwd; Sequencing Primer Sequence: 5'd[GGGCTGGCAAGCCACGTTTGGTG]3'; Tag: GST (Nterm); Bacteria Resistance: Ampicillin; Mammalian Selection: N/a; Catalog Number: 27-4598-01; Comments:P...
small image of pGEX-6P-3pGEX-6P-3 - Vendor:Amersham; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: tac; Expression Level: High (activate with IPTG); Sequencing Primer: pGEX Fwd; Sequencing Primer Sequence: 5'd[GGGCTGGCAAGCCACGTTTGGTG]3'; Tag: GST (Nterm); Bacteria Resistance: Ampicillin; Mammalian Selection: N/a; Catalog Number: 27-4599-01; Comments:P...

Plasmids 110 - 114Descriptions
small image of pGP704pGP704 - Comments:oligonucleotide adaptor. Hosts: E.coli. Related vectors: pUC18, R6K, lambda 1105. (Information source: VectorDB.)
small image of pHAT_10_11_12pHAT 10/11/12 - Vendor:Clontech; Vector Type: Bacterial; Promoter: lac; Sequencing Primer: HAT; Sequencing Primer Sequence: 5'd[GAGGAGCACGCTCATGCCCAC]3'; Tag: HAT (Nterm); Bacteria Resistance: Ampicillin; Catalog Number: 631205; Comments:Histidine Affinity Tag (HAT) for purification
small image of pHAT20pHAT20 - Vendor:Clontech; Vector Type: Bacterial; Promoter: lac; Sequencing Primer: HAT; Sequencing Primer Sequence: 5'd[GAGGAGCACGCTCATGCCCAC]3'; Tag: HAT (Nterm); Bacteria Resistance: Ampicillin; Catalog Number: 631202; Comments:Histidine Affinity Tag (HAT) for purification
small image of pHcRed1pHcRed1 - Vendor:Clontech; Vector Type: Bacterial; Promoter: lac; Tag: HcRed1 (Cterm); Bacteria Resistance: Ampicillin; Catalog Number: 632410; Comments:HcRed1 tag, far-red fluorescent protein
small image of pHSV-106pHSV-106 - Vendor:BRL; Comments:Created by Moore, July 1995, under contract with NCBI. Hosts: E.coli HB101. Related vectors: pBR322, HSV-1. (Information source: VectorDB.)

Plasmids 115 - 119Descriptions
small image of pHY300PLKpHY300PLK - GenBank Accession Number:D00054; Comments:PHY300PLK is one of the smallest hybrids of a new series of chimeric plasmids using the parental plasmids, pACYC177 of E.coli and pAM-alpha of Streptococcus faecalis. This shuttle vector for E.coli and B.subtilis contains an RNA primer gene for ori-177; the R-Tc gene; the R-Ap gene; Rep-alpha-1 gene, which is the plasmid replication gene; two replication ...
small image of PinPoint_ControlPinPoint Control - Vendor:Promega; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Bacteria Resistance: Ampicillin
small image of PinPoint_Xa_ControlPinPoint Xa Control - Vendor:Promega; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Tag: Factor Xa; Bacteria Resistance: Ampicillin; Catalog Number: V2041; Comments:Protein purification; no MCS
small image of PinPoint_Xa-1PinPoint Xa-1 - Vendor:Promega; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: Sp6 Rev; Bacteria Resistance: Ampicillin; Catalog Number: V2031; GenBank Accession Number:U47626; Comments:Protein purification; Xa-1, Xa-2, and Xa-3 have same MCS
small image of PinPoint_Xa-1_T-VectorPinPoint Xa-1 T-Vector - Vendor:Promega; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Bacteria Resistance: Ampicillin

Plasmids 120 - 124Descriptions
small image of PinPoint_Xa-2PinPoint Xa-2 - Vendor:Promega; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Bacteria Resistance: Ampicillin; Catalog Number: V2051; GenBank Accession Number:U47627; Comments:Protein purification; Xa-1, Xa-2, and Xa-3 have same MCS
small image of PinPoint_Xa-3PinPoint Xa-3 - Vendor:Promega; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Bacteria Resistance: Ampicillin; Catalog Number: V2061; GenBank Accession Number:U47628; Comments:Protein purification; Xa-1, Xa-2, and Xa-3 have same MCS
small image of pJB8pJB8 - Vendor:ATCC; Bacteria Resistance: Ampicillin; Catalog Number: 37074; GenBank Accession Number:X98612; Comments:Restriction digests analyzed on agarose gels give the following sizes (kb): HindIII--5.4; BamHI--5.4; PstI/HindIII--4.6, 0.8; PstI/SalI--3.3, 2.3. (ATCC staff) A cosmid vector containing a single cos site. [2] Cloning into the BamHI or EcoRI site involves 2 preparations of dephosphorylated vector,...
small image of pKG1800pKG1800 - Vendor:ATCC; Catalog Number: 37127; GenBank Accession Number:X51449; Comments:Created by Moore, July 1995, under contract with NCBI. Similar to pDS20. A terminator cloning plasmid vector. (ATCC staff) Insertion of terminator sequences at the cloning sites causes the galK+ phenotype to become galK-. galK+ plasmids are lethal on galETK hosts because of galactose-1-phosphate accumulation, so terminator-...
small image of pKH80pKH80 - Vendor:ATCC; Catalog Number: 37093; Comments:Created by Moore, July 1995, under contract with NCBI. An expression vector that can be propagated and selected for in either Bacillus subtilis or E.coli. (ATCC staff) Medium is 1227 LB plus ampicillin. Hosts: E.coli HB101, Bacillus subtilis, E.coli, Bacillus subtilis BD170. Related vectors: pBD9, pBR322. (Information source: VectorDB.)

Plasmids 125 - 129Descriptions
small image of pKJB1pKJB1 - Comments:Created by Moore, July 1995, under contract with NCBI. Hosts: E.coli. Related vectors: pUC8, Tn9. (Information source: VectorDB.)
small image of pKK16-2pKK16-2 - Comments:The deletion/replacement results in the removal of the -35 region of the tet promoter (and so makes low levels of TET) and part of the amp gene of the pKK9-4. Hosts: E.coli HB101, E.coli DH1. Related vectors: pKK9-4, pKK353-5. (Information source: VectorDB.)
small image of pKK175-6pKK175-6 - Comments:old Pharmacia vector. Hosts: E.coli HB101, E.coli DH1. Related vectors: pKK161-8, E.coli rrnB. (Information source: VectorDB.)
small image of pKK207-1pKK207-1 - Comments:Created by Moore, July 1995, under contract with NCBI. Hosts: E.coli W3110 lacIq, E.coli. Related vectors: pKK84-1, ptac11. (Information source: VectorDB.)
small image of pKK216-1pKK216-1 - Comments:Created by Moore, July 1995, under contract with NCBI. Hosts: E.coli W3110 lacIq, E.coli. Related vectors: pKK84-1, ptac11. (Information source: VectorDB.)

Plasmids 130 - 134Descriptions
small image of pKK223-3pKK223-3 - Vendor:Amersham; GenBank Accession Number:M77749; Comments:GenBank entry is not current with Pharmacia entry (1993). Hosts: E.coli JM105. Related vectors: pBR322, pKK10-2, ptacII, pUC8, pKK233-2, pKK232-8. (Information source: VectorDB.)
small image of pKK231-1pKK231-1 - Comments:Hosts: E.coli HB101, E.coli DH1. Related vectors: pKK175-6, pCM71, pKK9-4. (Information source: VectorDB.)
small image of pKK232-8pKK232-8 - Vendor:Amersham; Comments:Hosts: E.coli HB101, E.coli DH1. Related vectors: pBR322, pKK9-4, pKK353-5, pCM71, E.coli rrnB, pKK223-3, pKK233-2. (Information source: VectorDB.)
small image of pKK233-2pKK233-2 - Vendor:Clontech; GenBank Accession Number:X70478; Comments:Invitrogen sequence is 4523 bp & is the inverse-complement of this sequence. It is missing the first 2 bases gg and starts at base 3. It is missing aa after base 373. It has an extra t after base 3054. It has an extra a after base 3075. It is missing the bases after 4523. Hosts: E.coli JM109, E.coli W3110-LacIQ, E.coli RB791. Related vector...
small image of pKK353-5pKK353-5 - Comments:Hosts: E.coli HB101, E.coli DH1. Related vectors: pBR322. (Information source: VectorDB.)

Plasmids 135 - 139Descriptions
small image of pKK388-1pKK388-1 - Vendor:Clontech; Comments:Hosts: E.coli. Related vectors: pBR322. (Information source: VectorDB.)
small image of pKK67-4pKK67-4 - Comments:Hosts: E.coli HB101, E.coli DH1. Related vectors: pKK16-2. (Information source: VectorDB.)
small image of pKK84-1pKK84-1 - Comments:Hosts: E.coli HB101, E.coli DH1. Related vectors: pKK67-4. (Information source: VectorDB.)
small image of pKK92C-2pKK92C-2 - Comments:pKK84-1 has -35 region of tet promoter, but not -10 site. Hosts: E.coli HB101, E.coli DH1. Related vectors: pKK84-1. (Information source: VectorDB.)
small image of pKK9-4pKK9-4 - Comments:Hosts: E.coli HB101, E.coli DH1. Related vectors: pKK353-5, pBR322. (Information source: VectorDB.)



Copyright 2005 BVTech, Inc. All Rights Reserved

Search plasmid maps in this site
Google
Web biovisualtech.com
More Plasmid Map Templates
  • Bacterial
  • Bacterial expression
  • Cre/Lox
  • Insect expression
  • Lentiviral
  • Luciferase
  • Mammalian expression
  • Other
  • Retroviral
  • RNAi
  • Worm expression
  • Yeast expression
  • Bacterial vectors
  • Mammalian
  • Recent Release from EMBL

  • Free Software Downloads
    BVTech Photo Publisher
    Help you publish your pictures over the Internet or a local network so that other people can view them in their Web browsers
    HealthWatch
    A virtual apple a day to keep the doctor away
    Download VisualSniffer 2.0
    VisualSniffer is a powerful packet capture tool and protocol analyzer
    BVTech Plasmid
    A plasmid drawing software