image of the BVTech Plasmid

Bacterial expression Plasmids


HI0058 to pAC-Kan-alphaGal4 | pAED4 to pALTER-EX2 | pALTER-MAX to pBAD_His_B | pBAD_His_C to pBAD_myc-His_C | pBAD_myc-His_LacZ to pBAD18 | pBAD18-Cm to pBAD202_Directional_TOPO | pBAD24 to pBAD40 | pBAD42 to pBAD-DEST49 | pBAD-TOPO to pBlueScript_II_KS(+) | pBlueScript_II_SK(+) to pCMV-Tag3 | pCMV-Tag4 to pDEST14_Gateway | pDEST15_Gateway to pDsRed-Express | pECFP to pET-22bPlus | pET28a to pGEM-Sox2 | pGP-FB-orig_BA to pQLinkHD | pRK793 to TrmD_HaeIn | 

All plasmid maps listed here are created using BVTech Plasmid. If you do not have BVTech Plasmid, Click here to download the latest version of BVTech Plasmid

BVTech Plasmid is DNA sequence analysis and plasmid drawing software for Windows PCs.You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your DNA sequencing data, align sequences, and much more.

Free to try, $39.98 to buy

Payments will be processed by PayPal. PayPal is the safer, easier way to pay.

Plasmids 0 - 4Descriptions
small image of HI0058HI0058/pET-21a(+)c-tag - Gene/insert name: 3-deoxy-manno-octulosonate cytidylyltransferase; Alternative names: KDSB_HAEIN; GenBank/Entrez ID of insert: NC_000907; Gene/insert aliases: kdsB; Species of gene(s): Haemophilus influenzae; Fusion proteins or tags: His; Terminal: C terminal on insert; Vector backbone: pET-21a(+) (Search Vector Database); Backbone manufacturer: Merck; Cloning site 5'...
small image of LITMUS_28i_VectorLITMUS 28i Vector - Vendor:New England Biolabs; Vector Type: Bacterial; Promoter: T7; Sequencing Primer: M13; Bacteria Resistance: Ampicillin; Catalog Number: N3528S; Comments:Bacterial expression in phagemid vector
small image of LITMUS_38i_VectorLITMUS 38i Vector - Vendor:New England Biolabs; Vector Type: Bacterial; Promoter: T7; Sequencing Primer: M13; Bacteria Resistance: Ampicillin; Catalog Number: N3538S; Comments:Bacterial expression in phagemid vector
small image of pAcGFP1pAcGFP1 - Vendor:Clontech; Vector Type: Bacterial; Promoter: lac; Tag: GFP (N term); Bacteria Resistance: Ampicillin; Catalog Number: 632468, 632426; Comments:GFP fusion
small image of pAC-Kan-alphaGal4pAC-Kan-alphaGal4 - Gene/insert name: RNAP alpha-Gal4; Species of gene(s): Other; Vector backbone: pACLU-Kan (Search Vector Database); 5' Sequencing primer: AGA GCC TGA TAA AAA CGG TTA GCG (List of Sequencing Primers); Bacteria resistance: Kanamycin; High or low copy: Low Copy; Grow in standard E. coli @ 37C: No; Please specify bacterial strain for growth and growth condition: Needs...

Plasmids 5 - 9Descriptions
small image of pAED4pAED4 - Vendor:Paul Matsudaira Lab; Vector Type: Bacterial; Sequencing Primer: T7; Bacteria Resistance: Ampicillin
small image of pALTER-1pALTER-1 - Vendor:ATCC; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Bacteria Resistance: Tetracycline; Catalog Number: 68196; GenBank Accession Number:X65334; Comments:Mutagenesis vector; unique MCS
small image of pALTER-ControlpALTER-Control - Vendor:Promega; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Bacteria Resistance: Tetracycline; Comments:Mutagenesis vector
small image of pALTER-EX1pALTER-EX1 - Vendor:Promega; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Bacteria Resistance: Tetracycline; Catalog Number: Q6121; GenBank Accession Number:U47102; Comments:Mutagenesis vector; EX1 and EX2 have same MCS
small image of pALTER-EX2pALTER-EX2 - Vendor:Promega; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Bacteria Resistance: Tetracycline; Catalog Number: Q6111; GenBank Accession Number:U47103; Comments:Mutagenesis vector; EX1 and EX2 have same MCS, but EX2 uses p15a origin of replication

Plasmids 10 - 14Descriptions
small image of pALTER-MAXpALTER-MAX - Vendor:Promega; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Bacteria Resistance: Tetracycline; Catalog Number: Q5761; Comments:Mutagenesis vector; unique MCS
small image of pAmCyanpAmCyan - Vendor:Clontech; Vector Type: Bacterial; Promoter: lac; Tag: AmCyan (Nterm or Cterm); Bacteria Resistance: Ampicillin; Catalog Number: 632440, 630050; Comments:AmCyan fluorescent protein fusion
small image of pAsRed2pAsRed2 - Vendor:Clontech; Vector Type: Bacterial; Promoter: lac; Tag: AsRed2 (Nterm); Bacteria Resistance: Ampicillin; Catalog Number: 632451, 630050; Comments:AsRed2 fluorescent protein fusion
small image of pBAD_His_ApBAD/His A - Vendor:Invitrogen; Vector Type: Bacterial; Bacteria Resistance: Ampicillin
small image of pBAD_His_BpBAD/His B - Vendor:Invitrogen; Vector Type: Bacterial; Bacteria Resistance: Ampicillin

Plasmids 15 - 19Descriptions
small image of pBAD_His_CpBAD/His C - Vendor:Invitrogen; Vector Type: Bacterial; Bacteria Resistance: Ampicillin
small image of pBAD_His_LacZpBAD/His/LacZ - Vendor:Invitrogen; Vector Type: Bacterial; Bacteria Resistance: Ampicillin
small image of pBAD_myc-His_ApBAD/myc-His A - Vendor:Invitrogen; Vector Type: Bacterial; Bacteria Resistance: Ampicillin
small image of pBAD_myc-His_BpBAD/myc-His B - Vendor:Invitrogen; Vector Type: Bacterial; Bacteria Resistance: Ampicillin
small image of pBAD_myc-His_CpBAD/myc-His C - Vendor:Invitrogen; Vector Type: Bacterial; Bacteria Resistance: Ampicillin

Plasmids 20 - 24Descriptions
small image of pBAD_myc-His_LacZpBAD/myc-His/LacZ - Vendor:Invitrogen; Vector Type: Bacterial; Bacteria Resistance: Ampicillin
small image of pBAD_ThiopBAD/Thio - Vendor:Invitrogen; Vector Type: Bacterial; Bacteria Resistance: Ampicillin
small image of pBAD_Thio-TOPOpBAD/Thio-TOPO - Vendor:Invitrogen; Vector Type: Bacterial; Bacteria Resistance: Ampicillin
small image of pBAD102_Directional_TOPOpBAD102 Directional TOPO - Vendor:Invitrogen; Alternate Vector Names: pBAD102/D-TOPO; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: araBAD; Expression Level: Tightly controlled; Sequencing Primer: pBad Fwd; Sequencing Primer Sequence: 5'd[ATGCCATAGCATTTTTATCC]3'; Tag: 6X His, V5; Bacteria Resistance: Ampicillin; ...
small image of pBAD18pBAD18 - Vendor:Beckwith lab; Vector Type: Bacterial expression; Sequencing Primer Sequence: ctgtttctccatacccgtt; Bacteria Resistance: Ampicillin; Comments:Vector backbone:pKK223-3; Article: Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. Guzman LM et al. (J Bacteriol. 1995 Jul . 177(14):4121-30. Pubmed)

Plasmids 25 - 29Descriptions
small image of pBAD18-CmpBAD18-Cm - Vendor:Beckwith lab; Vector Type: Bacterial expression; Sequencing Primer Sequence: 5' ctgtttctccatacccgtt 3'ctcatccgccaaaacag; Bacteria Resistance: Chloramphenicol; Comments:Vector backbone: pKK223-3. Cloning site 5': NheI. Cloning site 3': HindIII.; Article: Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. Guzman LM et al. (J Bacteriol. ...
small image of pBAD18-KanpBAD18-Kan - Vendor:Beckwith Lab; Vector Type: Bacterial expression; Sequencing Primer: 5' ctgtttctccatacccgtt 3' ctcatccgccaaaacag; Bacteria Resistance: Kanamycin; Comments:Vector backbone: pKK223-3 Cloning site 5': NheI Cloning site 3': SphI; Article: Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. Guzman LM et al. (J Bacteriol. 1995 Jul . 177(14)...
small image of pBAD18spBAD18s - Vendor:Beckwith Lab; Vector Type: Bacterial expression; Sequencing Primer: 5' ctgtttctccatacccgtt 3' ctcatccgccaaaacag; Bacteria Resistance: Ampicillin; Comments:Vector backbone: pKK223-3 Cloning site 5': EcoRI Cloning site 3': HindIII; Article: Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. Guzman LM et al. (J Bacteriol. 1995 Jul . 177(14):...
small image of pBAD202_D_LacZpBAD202/D/LacZ - Vendor:Invitrogen; Vector Type: Bacterial; Bacteria Resistance: Ampicillin
small image of pBAD202_Directional_TOPOpBAD202 Directional TOPO - Vendor:Invitrogen; Alternate Vector Names: pBAD202/D-TOPO; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: araBAD; Expression Level: Tightly controlled; Sequencing Primer: pBad Fwd; Sequencing Primer Sequence: 5'd[ATGCCATAGCATTTTTATCC]3'; Tag: 6X His, V5; Bacteria Resistance: Kanamycin; M...

Plasmids 30 - 34Descriptions
small image of pBAD24pBAD24 - Vendor:Beckwith Lab; Vector Type: Bacterial Expression; Sequencing Primer Sequence: 5' ctgtttctccatacccgtt 3' ctcatccgccaaaacag; Bacteria Resistance: Ampicillin; Comments:Vector backbone: pKK223-3 Cloning site 5': NheI Cloning site 3': HindIII; Article: Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. Guzman LM et al. (J Bacteriol. 1995 Jul . 17...
small image of pBAD28pBAD28 - Vendor:Beckwith Lab; Vector Type: Bacterial Expression; Sequencing Primer Sequence: 5' ctgtttctccatacccgtt 3'ctcatccgccaaaacag; Bacteria Resistance: Ampicillin; Comments:Vector backbone: pACYC-184 Cloning site 5': SacI Cloning site 3': HindIII; Article: Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. Guzman LM et al. (J Bacteriol. 1995 Jul . 17...
small image of pBAD30pBAD30 - Vendor:Beckwith Lab; Vector Type: Bacterial Expression; Sequencing Primer Sequence: 5' ctgtttctccatacccgtt 3' ctcatccgccaaaacag; Bacteria Resistance: Ampicillin; Comments:Vector backbone: pACYC-184 Cloning site 5': EcoRI Cloning site 3': HindIII; Article: Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. Guzman LM et al. (J Bacteriol. 1995 Jul . ...
small image of pBAD33pBAD33 - Vendor:Beckwith Lab; Vector Type: Bacterial Expression; Sequencing Primer: 5' ctgtttctccatacccgtt 3' ctcatccgccaaaacag; Bacteria Resistance: Chloramphenicol; Comments:Vector backbone: pACYC-184 Cloning site 5': SacI Cloning site 3': HindIII; Article: Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. Guzman LM et al. (J Bacteriol. 1995 Jul . 177(1...
small image of pBAD40pBAD40 - Vendor:Beckwith Lab; Vector Type: Bacterial Expression; Sequencing Primer: 5' ctgtttctccatacccgtt 3'ctcatccgccaaaacag; Bacteria Resistance: Chloramphenicol; Comments:Vector backbone: pSC101 Cloning site 5': SalI Cloning site 3': EcoRI; Article: Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. Guzman LM et al. (J Bacteriol. 1995 Jul . 177(14):412...

Plasmids 35 - 39Descriptions
small image of pBAD42pBAD42 - Vendor:Beckwith Lab; Vector Type: Bacterial expression; Sequencing Primer: 5' ctgtttctccatacccgtt 3' ctcatccgccaaaacag; Bacteria Resistance: Spectinomycin; Comments:Vector backbone: pSC101 Cloning site 5': NheI Cloning site 3': HindIII; Article: Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. Guzman LM et al. (J Bacteriol. 1995 Jul . 177(14):41...
small image of pBAD43pBAD43 - Vendor:Beckwith Lab; Vector Type: Bacterial Expression; Sequencing Primer Sequence: 5' ctgtttctccatacccgtt 3' ctcatccgccaaaacag; Bacteria Resistance: Spectinomycin; Comments:Vector backbone: pSC101 Cloning site 5': NheI Cloning site 3': HindIII; Article: Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. Guzman LM et al. (J Bacteriol. 1995 Jul . 1...
small image of pBAD44pBAD44 - Vendor:Beckwith Lab; Vector Type: Bacterial Expression; Sequencing Primer Sequence: 5' ctgtttctccatacccgtt 3'ctcatccgccaaaacag; Bacteria Resistance: Chloramphenicol; Comments:Vector backbone: pSC101 Cloning site 5': NheI Cloning site 3': HIndIII; Article: Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. Guzman LM et al. (J Bacteriol. 1995 Jul . ...
small image of pBAD45pBAD45 - Vendor:Beckwith Lab; Vector Type: Bacterial Expression; Sequencing Primer Sequence: 5' ctgtttctccatacccgtt 3' ctcatccgccaaaacag; Bacteria Resistance: Chloramphenicol; Comments:Vector backbone: pSC101 Cloning site 5': NheI Cloning site 3': HIndIII; Article: Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. Guzman LM et al. (J Bacteriol. 1995 Jul ....
small image of pBAD-DEST49pBAD-DEST49 - Vendor:Invitrogen; Vector Type: Bacterial; Bacteria Resistance: Ampicillin

Plasmids 40 - 44Descriptions
small image of pBAD-TOPOpBAD-TOPO - Vendor:Invitrogen; Vector Type: Bacterial; Bacteria Resistance: Ampicillin
small image of pBAD-TOPO_LacZpBAD-TOPO/LacZ - Vendor:Invitrogen; Vector Type: Bacterial; Bacteria Resistance: Ampicillin
small image of pBAD-TOPO_LacZ_V5-HispBAD-TOPO/LacZ/V5-His - Vendor:Invitrogen; Vector Type: Bacterial; Bacteria Resistance: Ampicillin
small image of pBC_SK_+pBC SK + - Vendor:Stratagene; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Promoter: lac; Sequencing Primer: T7 Fwd; Bacteria Resistance: Chloamphenicol; Catalog Number: 212215; Comments:The SK designation indicates the polylinker is oriented such that beta-galactosidase (lacZ) transcription proceeds through the SacI site first and the KpnI site last.
small image of pBlueScript_II_KS(+)pBlueScript II KS(+) - Vendor:Stratagene; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Promoter: lac; Sequencing Primer: T7 Fwd; Bacteria Resistance: Ampicillin; GenBank Accession Number:X52327; Comments:MCS oriented as KpnI-SacI; f1 ori can be in either orientation; contains lacZ reporter

Plasmids 45 - 49Descriptions
small image of pBlueScript_II_SK(+)pBlueScript II SK(+) - Vector Type: Bacterial; Viral/Non-viral: Nonviral; Promoter: lac; Sequencing Primer: T7 Fwd; Bacteria Resistance: Ampicillin; GenBank Accession Number:X52328; Comments:MCS oriented as SacI-KpnI; f1 ori can be in either orientation; contains lacZ reporter
small image of pCMV-Sport_6pCMV-Sport 6 - Vendor:Invitrogen; Vector Type: Bacterial & mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: Sp6; Sequencing Primer Sequence: 5'd[GATTTAGGTGACACTATAG]3'; Tag: none; Bacteria Resistance: Ampicillin; Mammalian Selection: None
small image of pCMV-Tag1pCMV-Tag1 - Vendor:Stratagene; Vector Type: Bacterial & mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: CMVPro Fwd; Tag: myc, FLAG; Bacteria Resistance: Kanamycin; Mammalian Selection: G418; Catalog Number: 211170; Comments:Can be used in both mammalian and bacterial systems
small image of pCMV-Tag2pCMV-Tag2 - Vendor:Stratagene; Vector Type: Bacterial & mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: CMVPro Fwd; Tag: FLAG (Nterm); Bacteria Resistance: Kanamycin; Mammalian Selection: G418; Catalog Number: 211172; Comments:The sequence shown is for pCMV-Tag2A. (Tag2B and Tag2C are available ...
small image of pCMV-Tag3pCMV-Tag3 - Vendor:Stratagene; Vector Type: Bacterial & mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: CMVPro Fwd; Tag: myc (Nterm); Bacteria Resistance: Kanamycin; Mammalian Selection: G418; Catalog Number: 211173; Comments:The sequence shown is for pCMV-Tag3A. (Stratagene also offers Tag3B an...

Plasmids 50 - 54Descriptions
small image of pCMV-Tag4pCMV-Tag4 - Vendor:Stratagene; Vector Type: Bacterial & mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: CMVPro Fwd; Tag: FLAG (Cterm); Bacteria Resistance: Kanamycin; Mammalian Selection: G418; Catalog Number: 211174; Comments:The sequence shown is for pCMV-Tag4A. (Stratagene also offers Tag4B a...
small image of pCMV-Tag5pCMV-Tag5 - Vendor:Stratagene; Vector Type: Bacterial & mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: CMVPro Fwd; Tag: myc (Cterm); Bacteria Resistance: Kanamycin; Mammalian Selection: G418; Catalog Number: 211175; Comments:The sequence shown is for pCMV-Tag5A. (Stratagene also sells Tag5B and...
small image of pCRT7_CT-TOPOpCRT7/CT-TOPO - Vendor:Invitrogen; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, V5; Bacteria Resistance: Ampicillin; Mammalian Selection: Zeocin; Catalog Number: K421101
small image of pCRT7_NT-TOPOpCRT7/NT-TOPO - Vendor:Invitrogen; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, Xpress; Bacteria Resistance: Ampicillin; Mammalian Selection: Zeocin; Catalog Number: K420101
small image of pDEST14_GatewaypDEST14 Gateway - Vendor:Invitrogen; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: n/a; Expression Level: Tightly controlled (use w/ BL21-AI); Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: no tag; Bacteria Resistance: Ampicillin; Mammalian Selection: N/a; Catalog Number: 11801016...

Plasmids 55 - 59Descriptions
small image of pDEST15_GatewaypDEST15 Gateway - Vendor:Invitrogen; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: n/a; Expression Level: Tightly controlled (use w/ BL21-AI); Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: GST (Nterm); Bacteria Resistance: Ampicillin; Mammalian Selection: N/a; Catalog Number: 118...
small image of pDEST17_GatewaypDEST17 Gateway - Vendor:Invitrogen; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: n/a; Expression Level: Tightly controlled (use w/ BL21-AI); Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His (Nterm); Bacteria Resistance: Ampicillin; Mammalian Selection: N/a; Catalog Number: ...
small image of pDEST24_GatewaypDEST24 Gateway - Vendor:Invitrogen; Vector Type: Bacterial; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: n/a; Expression Level: Tightly controlled (use w/ BL21-AI); Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: GST (Cterm); Bacteria Resistance: Ampicillin; Mammalian Selection: N/a; Catalog Number: 122...
small image of pDsRed2pDsRed2 - Vendor:Clontech; Vector Type: Bacterial; Promoter: lac; Sequencing Primer: DsRed1-N; Sequencing Primer Sequence: 5'd[GTACTGGAACTGGGGGGACAG]; Tag: DsRed2; Bacteria Resistance: Ampicillin; Catalog Number: 632404; Comments:Red fluorescent protein tag variant
small image of pDsRed-ExpresspDsRed-Express - Vendor:Clontech; Vector Type: Bacterial; Promoter: lac; Sequencing Primer: DsRed; Sequencing Primer Sequence: 5'd[GTACTGGAACTGGGGGGACAG]; Tag: DsRed-Express; Bacteria Resistance: Ampicillin; Catalog Number: 632412; Comments:Red fluorescent protein tag

Plasmids 60 - 64Descriptions
small image of pECFPpECFP - Vendor:Clontech; Vector Type: Bacterial; Promoter: lac; Sequencing Primer: EGFP-N; Sequencing Primer Sequence: 5'd[CGTCGCCGTCCAGCTCGACCAG]3'; Tag: ECFP; Bacteria Resistance: Ampicillin; Catalog Number: 6075-1; Comments:Cyan variant of GFP tag
small image of pEGFPpEGFP - Vendor:Clontech; Vector Type: Bacterial; Promoter: lac; Sequencing Primer: EGFP-N; Sequencing Primer Sequence: 5'd[CGTCGCCGTCCAGCTCGACCAG]3'; Tag: EGFP; Bacteria Resistance: Ampicillin; Catalog Number: 6077-1; Comments:EGFP tag
small image of pET-21a_RecRpET-21a(+)-HP RecR - Gene/insert name: Helicobacter pylori RecR; Alternative names: HP RecR; GenBank/Entrez ID of insert: NC_000915; Gene/insert aliases: recR; Species of gene(s): Helicobacter pylori; Fusion proteins or tags: His; Terminal: C terminal on backbone; Vector backbone: pET21a(+) (Search Vector Database); Backbone manufacturer: Novagen; Cloning site 5': NdeI; Site destroyed...
small image of pET-21aPluspET-21a(+)-AroQ - Gene/insert name: type II dehydroquinase; Alternative names: 3-dehydroquinate dehydratase; GenBank/Entrez ID of insert: HP1038; Gene/insert aliases: HP1038; Species of gene(s): Helicobacter pylori; Fusion proteins or tags: His; Terminal: C terminal on backbone; Vector backbone: pET-21a(+) (Search Vector Database); Backbone manufacturer: Novagen; Cloning site 5': NdeI;...
small image of pET-22bPluspET-22b(+)-HpENR - Gene/insert name: noyl-acyl carrier protein reductase; Alternative names: ENR; GenBank/Entrez ID of insert: AAD05765; Gene/insert aliases: fabI; Species of gene(s): Helicobacter pylori; Vector backbone: pET-22b(+) (Search Vector Database); Backbone manufacturer: Novagen; Cloning site 5': NdeI; Site destroyed during cloning: No; Cloning site 3': BamHI; Site destroyed ...

Plasmids 65 - 69Descriptions
small image of pET28apET28a - Vendor: EMD Biosciences; Alternate Vector Names: pET-28 a (+); Vector Type: Bacterial expression; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His (Nterm and Cterm); Bacteria Resistance: Kanamycin; Catalog Number: 69864-...
small image of pGEM-LIN28pGEM-LIN28 - Gene/insert name: Homo sapiens lin-28 homolog (C. elegans); Alternative names: LIN28; GenBank/Entrez ID of insert: NM_024674; Gene/insert aliases: LIN28, CSDD1, LIN-28, LIN28A, ZCCHC1, FLJ12457; Species of gene(s): H. sapiens (human); Vector backbone: pGEM-T Easy (Search Vector Database); Backbone manufacturer: Promega; 5' Sequencing primer: T7 (List of Sequencing Primers); 3'...
small image of pGEM-NanogpGEM-Nanog - Gene/insert name: Homo sapiens Nanog homeobox; Alternative names: NANOG; GenBank/Entrez ID of insert: NM_024865; Gene/insert aliases: NANOG; Species of gene(s): H. sapiens (human); Vector backbone: pGEM-T Easy (Search Vector Database); Backbone manufacturer: Promega; 5' Sequencing primer: M13 Reverse (List of Sequencing Primers); 3' Sequencing primer: T7; Bacteria resistance...
small image of pGEM-Oct4pGEM-Oct4 - Gene/insert name: Homo sapiens POU domain, class 5, transcription factor 1 (POU5F1); Alternative names: POU5F1; Oct4; GenBank/Entrez ID of insert: NM_002701; Gene/insert aliases: POU5F1, OCT3, OCT4, OTF3, OTF4, MGC22487; Species of gene(s): H. sapiens (human); Vector backbone: pGEM-T Easy (Search Vector Database); Backbone manufacturer: Promega; 5' Sequencing primer: M13 Revers...
small image of pGEM-Sox2pGEM-Sox2 - Gene/insert name: Homo sapiens SRY (sex determining region Y)-box 2 (SOX2); Alternative names: Sox2; GenBank/Entrez ID of insert: NM_003106; Gene/insert aliases: SOX2, ANOP3, MCOPS3, MGC2413; Species of gene(s): H. sapiens (human); Vector backbone: pGEM-T Easy (Search Vector Database); Backbone manufacturer: Promega; 5' Sequencing primer: T7 (List of Sequencing Primers); 3' Sequ...

Plasmids 70 - 74Descriptions
small image of pGP-FB-orig_BApGP-FB-orig BA - Gene/insert name: orig BA; Alternative names: original BCR-ABL three-finger array; Species of gene(s): Other; Fusion proteins or tags: Gal11P; Terminal: N terminal on backbone; Vector backbone: pGP-FB (Search Vector Database); Cloning site 5': XbaI; Site destroyed during cloning: No; Cloning site 3': BamHI; Site destroyed during cloning: No; 5' Sequencing primer: ...
small image of pGP-FFpGP-FF - Fusion proteins or tags: Gal11P ; Terminal: N terminal on backbone; Vector backbone: pGP-FF ; Cloning site 5': XbaI ; Site destroyed during cloning: No ; Cloning site 3': BsgI ; Site destroyed during cloning: No ; 5' Sequencing primer: GGG GGA TTT CTG TTC ATG GGG G ; Bacteria resistance: Ampicillin ; High or low copy: Low Copy ; Grow in standard E. coli ...
small image of pGT2Vector backbone: pGT2 - Cloning site 5': XcmI, HindIII, StyI, BspEI, EcoRV ; Site destroyed during cloning: No ; Cloning site 3': XcmI, SacI, SpeI, NotI, EcoRI, AatII ; Site destroyed during cloning: No ; 5' Sequencing primer: M13/pUC Reverse (List of Sequencing Primers) ; Bacteria resistance: Ampicillin ; High or low copy: High Copy ; Grow in standard E. coli @ 37C: Yes...
small image of pQLinkHpQLinkH - Gene/insert name: multi cloning site ; Alternative names: pQTEV3 ; GenBank/Entrez ID of insert: EF025688 ; Fusion proteins or tags: His ; Terminal: N terminal on backbone; Fusion proteins or tags: attB1 ; Terminal: N terminal on backbone ; Fusion proteins or tags: TEV ; Terminal: N terminal on backbone; Vector backbone: pQE-2; Backbone manufacturer:...
small image of pQLinkHDpQLinkHD - Gene/insert name: Gateway cassette ; Alternative names: pDESTco ; GenBank/Entrez ID of insert: EF025686 ; Fusion proteins or tags: His ; Terminal: N terminal on backbone; Vector backbone: pQE-2 ; Backbone manufacturer: Qiagen; Cloning site 5': attR1 ; Site destroyed during cloning: Yes ; Cloning site 3': attR2 ; Site destroyed during cloning: Yes...

Plasmids 75 - 79Descriptions
small image of pRK793pRK793 - Gene/insert name: TEV protease, S219V mutant; Alternative names: tobacco etch virus protease; Species of gene(s): Other; Relevant mutations/deletions: S219V mutation; Fusion proteins or tags: His; Terminal: N terminal on insert; Fusion proteins or tags: polyarginine; Terminal: C terminal on insert; Vector backbone: pMal-C2 (Search Vector Database); Backbone manufacturer: New Englan...
small image of TrmD_HaeInTrmD_HaeIn/pET28b(+) N,C-tag - Gene/insert name: tRNA (guanine-N(1)-)-methyltransferase; Alternative names: TrmD; GenBank/Entrez ID of insert: L42023; Gene/insert aliases: trmD; Species of gene(s): Haemophilus influenzae; Fusion proteins or tags: His; Terminal: N terminal on insert; Fusion proteins or tags: His; Terminal: C terminal on insert; Vector backbone: pET-28b(+) (Search Vector ...



Copyright 2005 BVTech, Inc. All Rights Reserved

Search plasmid maps in this site
Google
Web biovisualtech.com
More Plasmid Map Templates
  • Bacterial expression
  • Bacterial expression
  • Cre/Lox
  • Insect expression
  • Lentiviral
  • Luciferase
  • Mammalian expression
  • Other
  • Retroviral
  • RNAi
  • Worm expression
  • Yeast expression
  • Bacterial vectors
  • Mammalian
  • Recent Release from EMBL

  • Free Software Downloads
    BVTech Photo Publisher
    Help you publish your pictures over the Internet or a local network so that other people can view them in their Web browsers
    HealthWatch
    A virtual apple a day to keep the doctor away
    Download VisualSniffer 2.0
    VisualSniffer is a powerful packet capture tool and protocol analyzer
    BVTech Plasmid
    A plasmid drawing software