BV Tech Plasmid
Plasmid drawing software

Bacterial expression Plasmids

  • pGT2
    Vector backbone: pGT2
    Type of vector: Bacterial expression
    Backbone size (bp): 3267
    Cloning site 5': XcmI, HindIII, StyI, BspEI, EcoRV
    Site destroyed during cloning: No
    Cloning site 3': XcmI, SacI, SpeI, NotI, EcoRI, AatII
    Site destroyed during cloning: No
    5' Sequencing primer: M13/pUC Reverse (List of Sequencing Primers)
    Bacteria resistance: Ampicillin
    High or low copy: High Copy
    Grow in standard E. coli @ 37C: Yes
    If you did not originally clone this gene, from whom and where did you receive the plasmid used to derive this plasmid: Modified from pGFPTA (Husimi et al, 2000)
    Comments: pGT2 is an XcmI generated T-vector bearing GFP marker optimized for direct cloning. Colonies with insert are selected by GFP inactivation.
  • pQLinkH
    Gene/insert name: multi cloning site
    Alternative names: pQTEV3
    Insert size (bp): 28
    GenBank/Entrez ID of insert: EF025688
    Fusion proteins or tags: His
    Terminal: N terminal on backbone
    Fusion proteins or tags: attB1
    Terminal: N terminal on backbone
    Fusion proteins or tags: TEV
    Terminal: N terminal on backbone
    Vector backbone: pQE-2
    Backbone manufacturer: Qiagen
    Type of vector: Bacterial expression,Co-expression
    Backbone size (bp): 4873
    Cloning site 5': BamHI
    Site destroyed during cloning: No
    Cloning site 3': NotI
    Site destroyed during cloning: No
    5' Sequencing primer: pQE65, TGAGCGGATAACAATTTCACACAG
    3' Sequencing primer: pQE276, GGCAACCGAGCGTTCTGAAC
    Bacteria resistance: Ampicillin
    High or low copy: Don't Know
    Grow in standard E. coli @ 37C: Yes
    Plasmid Provided In: DH5a
    Principal Investigator: Konrad Buessow
    Article: Vectors for co-expression of an unrestricted number of proteins. Scheich C et al. (Nucleic Acids Res. 2007 Feb 20. ():. Pubmed)
  • pQLinkHD
    Gene/insert name: Gateway cassette
    Alternative names: pDESTco
    Insert size (bp): 2342
    GenBank/Entrez ID of insert: EF025686
    Fusion proteins or tags: His
    Terminal: N terminal on backbone
    Vector backbone: pQE-2
    Backbone manufacturer: Qiagen
    Type of vector: Bacterial expression,Co-Expression
    Backbone size (bp): 7062
    Cloning site 5': attR1
    Site destroyed during cloning: Yes
    Cloning site 3': attR2
    Site destroyed during cloning: Yes
    5' Sequencing primer: pQE65, TGAGCGGATAACAATTTCACACAG
    3' Sequencing primer: pQE276, GGCAACCGAGCGTTCTGAAC
    Bacteria resistance: Ampicillin
    High or low copy: Don't Know
    Grow in standard E. coli @ 37C: No
    Please specify bacterial strain for growth and growth condition: DB3.1 from Invitrogen
    Plasmid Provided In: DB3.1
    Principal Investigator: Konrad Buessow
    Article: Vectors for co-expression of an unrestricted number of proteins. Scheich C et al. (Nucleic Acids Res. 2007 Feb 20. ():. Pubmed)
  • pGP-FF
    Fusion proteins or tags: Gal11P
    Terminal: N terminal on backbone
    Vector backbone: pGP-FF
    Type of vector: Bacterial expression
    Backbone size (bp): 3483
    Cloning site 5': XbaI
    Site destroyed during cloning: No
    Cloning site 3': BsgI
    Site destroyed during cloning: No
    5' Sequencing primer: GGG GGA TTT CTG TTC ATG GGG G
    Bacteria resistance: Ampicillin
    High or low copy: Low Copy
    Grow in standard E. coli @ 37C: No
    Please specify bacterial strain for growth and growth condition: Needs strain with lacIq Plasmid Provided In: XL1 Blue
    Principal Investigator: Keith Joung
    Comments: Bacterial cell-based two-hybrid (B2H) expression vector. Encodes zinc finger-Gal11P hybrid protein. This plasmid is a corrected version of pGP-FB. Note that the BsgI site (not pictured in the map below) cuts at base 420. pGP-FF requires a bacterial strain, such as XL1 Blue, that expresses the lacIq allele of lac repressor. This ensures repression of the strong lacUV5 promoter, which directs expression of the zinc finger-Gal11P hybrid protein.



  • Copyright 2005 BVTech, Inc. All Rights Reserved

    Search
    Google
    Web biovisualtech.com
    Free Software Downloads
    BVTech Photo Publisher
    Help you publish your pictures over the Internet or a local network so that other people can view them in their Web browsers
    HealthWatch
    A virtual apple a day to keep the doctor away
    Download VisualSniffer 2.0
    VisualSniffer is a powerful packet capture tool and protocol analyzer
    BVTech Plasmid
    A plasmid drawing software