|
pGT2
Vector backbone: pGT2
Type of vector: Bacterial expression
Backbone size (bp): 3267
Cloning site 5': XcmI, HindIII, StyI, BspEI, EcoRV
Site destroyed during cloning: No
Cloning site 3': XcmI, SacI, SpeI, NotI, EcoRI, AatII
Site destroyed during cloning: No
5' Sequencing primer: M13/pUC Reverse (List of Sequencing Primers)
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
If you did not originally clone this gene, from whom and where did you receive the plasmid used to derive this plasmid: Modified from pGFPTA (Husimi et al, 2000)
Comments: pGT2 is an XcmI generated T-vector bearing GFP marker optimized for direct cloning. Colonies with insert are selected by GFP inactivation.
pQLinkH
Gene/insert name: multi cloning site
Alternative names: pQTEV3
Insert size (bp): 28
GenBank/Entrez ID of insert: EF025688
Fusion proteins or tags: His
Terminal: N terminal on backbone
Fusion proteins or tags: attB1
Terminal: N terminal on backbone
Fusion proteins or tags: TEV
Terminal: N terminal on backbone
Vector backbone: pQE-2
Backbone manufacturer: Qiagen
Type of vector: Bacterial expression,Co-expression
Backbone size (bp): 4873
Cloning site 5': BamHI
Site destroyed during cloning: No
Cloning site 3': NotI
Site destroyed during cloning: No
5' Sequencing primer: pQE65, TGAGCGGATAACAATTTCACACAG
3' Sequencing primer: pQE276, GGCAACCGAGCGTTCTGAAC
Bacteria resistance: Ampicillin
High or low copy: Don't Know
Grow in standard E. coli @ 37C: Yes
Plasmid Provided In: DH5a
Principal Investigator: Konrad Buessow
Article: Vectors for co-expression of an unrestricted number of proteins. Scheich C et al. (Nucleic Acids Res. 2007 Feb 20. ():. Pubmed)
pQLinkHD
Gene/insert name: Gateway cassette
Alternative names: pDESTco
Insert size (bp): 2342
GenBank/Entrez ID of insert: EF025686
Fusion proteins or tags: His
Terminal: N terminal on backbone
Vector backbone: pQE-2
Backbone manufacturer: Qiagen
Type of vector: Bacterial expression,Co-Expression
Backbone size (bp): 7062
Cloning site 5': attR1
Site destroyed during cloning: Yes
Cloning site 3': attR2
Site destroyed during cloning: Yes
5' Sequencing primer: pQE65, TGAGCGGATAACAATTTCACACAG
3' Sequencing primer: pQE276, GGCAACCGAGCGTTCTGAAC
Bacteria resistance: Ampicillin
High or low copy: Don't Know
Grow in standard E. coli @ 37C: No
Please specify bacterial strain for growth and growth condition: DB3.1 from Invitrogen
Plasmid Provided In: DB3.1
Principal Investigator: Konrad Buessow
Article: Vectors for co-expression of an unrestricted number of proteins. Scheich C et al. (Nucleic Acids Res. 2007 Feb 20. ():. Pubmed)
pGP-FF
Fusion proteins or tags: Gal11P
Terminal: N terminal on backbone
Vector backbone: pGP-FF
Type of vector: Bacterial expression
Backbone size (bp): 3483
Cloning site 5': XbaI
Site destroyed during cloning: No
Cloning site 3': BsgI
Site destroyed during cloning: No
5' Sequencing primer: GGG GGA TTT CTG TTC ATG GGG G
Bacteria resistance: Ampicillin
High or low copy: Low Copy
Grow in standard E. coli @ 37C: No
Please specify bacterial strain for growth and growth condition: Needs strain with lacIq
Plasmid Provided In: XL1 Blue
Principal Investigator: Keith Joung
Comments: Bacterial cell-based two-hybrid (B2H) expression vector. Encodes zinc finger-Gal11P hybrid protein. This plasmid is a corrected version of pGP-FB.
Note that the BsgI site (not pictured in the map below) cuts at base 420. pGP-FF requires a bacterial strain, such as XL1 Blue, that expresses the lacIq allele of lac repressor. This ensures repression of the strong lacUV5 promoter, which directs expression of the zinc finger-Gal11P hybrid protein.
|