image of the BVTech Plasmid

Insect expression Plasmids


pAc5.1_V5-His_A to pDEST20 | pDEST8 to pFastBacHT_C | pIB_His to pIB_V5-His-DEST | pIB_V5-His-TOPO to pMT_V5-His-TOPO | pPacPL to pTriEx-3 | 

All plasmid maps listed here are created using BVTech Plasmid. If you do not have BVTech Plasmid, Click here to download the latest version of BVTech Plasmid

BVTech Plasmid is DNA sequence analysis and plasmid drawing software for Windows PCs.You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your DNA sequencing data, align sequences, and much more.

Free to try, $39.98 to buy

Payments will be processed by PayPal. PayPal is the safer, easier way to pay.

Plasmids 0 - 4Descriptions
small image of pAc5.1_V5-His_ApAc5.1/V5-His A - Vendor: Invitrogen; Vector Type: Insect; Viral/Non-viral: Viral; Constitutive/Inducible: Constitutive; Promoter: P-AC5 (Actin 5C); Sequencing Primer: AC5; Sequencing Primer Sequence: 5'd[ACACAAAGCCGCTCCATCAG]3'; Tag: V5 (Cterm), His (Cterm); Bacteria Resistance: Ampicillin; Catalog Number: V411020; Comments: Constitutive insect cell expression. Can use pCoHygro or p...
small image of pAc5.1_V5-His_BpAc5.1/V5-His B - Vendor:Invitrogen; Vector Type: Insect; Viral/Non-viral: Viral; Constitutive/Inducible: Constitutive; Promoter: P-AC5 (Actin 5C); Sequencing Primer: AC5; Sequencing Primer Sequence: 5'd[ACACAAAGCCGCTCCATCAG]3'; Tag: V5 (Cterm), His (Cterm); Bacteria Resistance: Ampicillin; Catalog Number: V411020; Comments:Constitutive insect cell expression. Can use pCoHygro or pCoBlast for selection.
small image of pAc5.1_V5-His_CpAc5.1/V5-His C - Vendor:Invitrogen; Vector Type: Insect; Viral/Non-viral: Viral; Constitutive/Inducible: Constitutive; Promoter: P-AC5 (Actin 5C); Sequencing Primer: AC5; Sequencing Primer Sequence: 5'd[ACACAAAGCCGCTCCATCAG]3'; Tag: V5 (Cterm), His (Cterm); Bacteria Resistance: Ampicillin; Catalog Number: V411020; Comments:Constitutive insect cell expression. Can use pCoHygro or pCoBlast for selection.
small image of pDEST10pDEST10 - Vendor:Invitrogen; Vector Type: Insect; Viral/Non-viral: Baculoviral; Constitutive/Inducible: Constitutive; Promoter: polyhedrin (P-PH); Sequencing Primer: Polyhedrin; Sequencing Primer Sequence: 5'd[AAATGATAACCATCTCGC]3'; Tag: His (Nterm); Bacteria Resistance: Ampicillin; Mammalian Selection: Gentamicin; Catalog Number: 11806015, 11827011; Comments:For use with Gateway Technology
small image of pDEST20pDEST20 - Vendor: Invitrogen; Vector Type: Insect expression; Viral/Non-viral: Baculoviral; Constitutive/Inducible: Constitutive; Promoter: polyhedrin (P-PH); Sequencing Primer: Polyhedrin; Sequencing Primer Sequence: 5'd[AAATGATAACCATCTCGC]3'; Tag: GST (Nterm); Bacteria Resistance: Ampicillin; Mammalian Selection: Gentamicin; Catalog Number: 11807013, 11827011; Comments: For use with Gate...

Plasmids 5 - 9Descriptions
small image of pDEST8pDEST8 - Vendor:Invitrogen; Vector Type: Insect; Viral/Non-viral: Baculoviral; Constitutive/Inducible: Constitutive; Promoter: polyhedrin (P-PH); Sequencing Primer: Polyhedrin; Sequencing Primer Sequence: 5'd[AAATGATAACCATCTCGC]3'; Bacteria Resistance: Ampicillin; Mammalian Selection: Gentamicin; Catalog Number: 11804010,11827011; Comments:For use with Gateway Technology
small image of pFastBac_DualpFastBac Dual - Vendor: Invitrogen; Vector Type: Insect expression; Viral/Non-viral: Baculoviral; Constitutive/Inducible: Constitutive; Promoter: P-P10 and P-Pol; Bacteria Resistance: Ampicillin; Mammalian Selection: Gentamicin; Catalog Number: 10712024; Comments: Expression of 2 proteins simultaneously in insect cells
small image of pFastBacHT_ApFastBacHT A - Vendor:Invitrogen; Vector Type: Insect; Viral/Non-viral: Baculoviral; Constitutive/Inducible: Constitutive; Promoter: polyhedrin (P-PH); Sequencing Primer: Polyhedrin; Sequencing Primer Sequence: 5'd[AAATGATAACCATCTCGC]3'; Tag: His (Nterm); Bacteria Resistance: Ampicillin; Mammalian Selection: Gentamicin; Catalog Number: 10584027; Comments:Purification of his-tagged proteins from insect cel...
small image of pFastBacHT_BpFastBacHT B - Vendor:Invitrogen; Vector Type: Insect; Viral/Non-viral: Baculoviral; Constitutive/Inducible: Constitutive; Promoter: polygedrin (P-PH); Sequencing Primer: Polyhedrin; Sequencing Primer Sequence: 5'd[AAATGATAACCATCTCGC]3'; Tag: His (Nterm); Bacteria Resistance: Ampicillin; Mammalian Selection: Gentamicin; Catalog Number: 10584027; Comments:Purification of his-tagged proteins from insect cel...
small image of pFastBacHT_CpFastBacHT C - Vendor:Invitrogen; Vector Type: Insect; Viral/Non-viral: Baculoviral; Constitutive/Inducible: Constitutive; Promoter: polyhedrin (P-PH); Sequencing Primer: Polyhedrin; Sequencing Primer Sequence: 5'd[AAATGATAACCATCTCGC]3'; Tag: His (Nterm); Bacteria Resistance: Ampicillin; Mammalian Selection: Gentamicin; Catalog Number: 10584027; Comments:Purification of his-tagged proteins from insect cel...

Plasmids 10 - 14Descriptions
small image of pIB_HispIB/His - Vendor:Invitrogen; Vector Type: Insect; Viral/Non-viral: Viral; Stable/Transient: Stable; Constitutive/Inducible: Constitutive; Promoter: OpIE2; Sequencing Primer: OpIE2; Sequencing Primer Sequence: 5'd[CGCAACGATCTGGTAAACAC]3'; Tag: Xpress (N), His (N); Bacteria Resistance: Ampicillin; Mammalian Selection: Blasticidin; Catalog Number: V804001; Comments:Stable expression of gene in insect cells.
small image of pIB_His_BpIB/His B - Vendor:Invitrogen; Vector Type: Insect; Viral/Non-viral: Viral; Stable/Transient: Stable; Constitutive/Inducible: Constitutive; Promoter: OpIE2; Sequencing Primer: OpIE2; Sequencing Primer Sequence: 5'd[CGCAACGATCTGGTAAACAC]3'; Tag: Xpress (N), His (N); Bacteria Resistance: Ampicillin; Mammalian Selection: Blasticidin; Catalog Number: V804001; Comments:Stable expression of gene in insect cells.
small image of pIB_His_CpIB/His C - Vendor:Invitrogen; Vector Type: Insect; Viral/Non-viral: Viral; Stable/Transient: Stab/e; Constitutive/Inducible: Constitutive; Promoter: OpIE2; Sequencing Primer: OpIE2; Sequencing Primer Sequence: 5'd[CGCAACGATCTGGTAAACAC]3'; Tag: Xpress (N), His (N); Bacteria Resistance: Ampicillin; Mammalian Selection: Blasticidin; Catalog Number: V804001; Comments:Stable expression of gene in insect cells.
small image of pIB_V5-HispIB/V5-His - Vendor: Invitrogen; Vector Type: Insect expression; Viral/Non-viral: Viral; Stable/Transient: Stable; Constitutive/Inducible: Constitutive; Promoter: OpIE2; Sequencing Primer: OpIE2; Sequencing Primer Sequence: 5'd[CGCAACGATCTGGTAAACAC]3'; Tag: V5 (Cterm), His (Cterm); Bacteria Resistance: Ampicillin; Mammalian Selection: Blasticidin; Catalog Number: V802001; Comments: St...
small image of pIB_V5-His-DESTpIB/V5-His-DEST - Vendor:Invitrogen; Vector Type: Insect; Viral/Non-viral: Viral; Stable/Transient: Stable; Constitutive/Inducible: Constitutive; Promoter: OpIE2; Sequencing Primer: OpIE2; Sequencing Primer Sequence: 5'd[CGCAACGATCTGGTAAACAC]3'; Tag: V5 (Cterm), His (Cterm); Bacteria Resistance: Ampicillin; Mammalian Selection: Blasticidin; Catalog Number: 12550018; Comments:Stable expression of gene i...

Plasmids 15 - 19Descriptions
small image of pIB_V5-His-TOPOpIB/V5-His-TOPO - Vendor:Invitrogen; Vector Type: Insect; Viral/Non-viral: Viral; Stable/Transient: Stable; Constitutive/Inducible: Constitutive; Promoter: OpIE2; Sequencing Primer: OpIE2; Sequencing Primer Sequence: 5'd[CGCAACGATCTGGTAAACAC]3'; Tag: V5 (Cterm), His (Cterm); Bacteria Resistance: Ampicillin; Mammalian Selection: Blasticidin; Catalog Number: K89020; Comments:Stable expression of gene in ...
small image of pIB-E_EchopIB-E Echo - Vendor:Invitrogen; Vector Type: Insect; Viral/Non-viral: Viral; Stable/Transient: Stable; Constitutive/Inducible: Constitutive; Promoter: OpIE2; Sequencing Primer: OpIE2; Sequencing Primer Sequence: 5'd[CGCAACGATCTGGTAAACAC]3'; Mammalian Selection: Blasticidin; Catalog Number: ET32001; Comments:Stable expression of gene in insect cells. For use with Echo cloning system.
small image of pIZ_V5-HispIZ/V5-His - Vendor: Invitrogen; Vector Type: Insect; Viral/Non-viral: Viral; Stable/Transient: Stable; Constitutive/Inducible: Constitutive; Promoter: OpIE2; Sequencing Primer: OpIE2; Sequencing Primer Sequence: 5'd[CGCAACGATCTGGTAAACAC]3'; Tag: V5 (Cterm), His (Cterm); Bacteria Resistance: Ampicillin; Mammalian Selection: Zeocin; Catalog Number: V800001, K80501, K80001; Comments: St...
small image of pMT_V5-His_ApMT/V5-His A - Vendor: Invitrogen; Vector Type: Insect expression; Viral/Non-viral: Viral; Constitutive/Inducible: Inducible (Copper sulfate or cadmium chloride); Promoter: P-MT (Metallothionein); Sequencing Primer: Metallothionein; Sequencing Primer Sequence: 5'd[CATCTCAGTGCAACTAAA]3'; Tag: V5 (Cterm), His (Cterm); Bacteria Resistance: Ampicillin; Catalog Number: V412020; Comments: Ind...
small image of pMT_V5-His-TOPOpMT/V5-His-TOPO - Vendor: Invitrogen; Vector Type: Insect expression; Viral/Non-viral: Viral; Constitutive/Inducible: Inducible (Copper sulfate or cadmium chloride); Promoter: P-MT (Metallothionein); Sequencing Primer: Metallothionein; Sequencing Primer Sequence: 5'd[CATCTCAGTGCAACTAAA]3'; Tag: V5 (Cterm), His (Cterm); Bacteria Resistance: Ampicillin; Catalog Number: K412501; Comment...

Plasmids 20 - 24Descriptions
small image of pPacPLpPacPL - Vendor: FlyBase; Vector Type: Insect; Backbone Size (bp): 6400
small image of pTriEx-3pTriEx-3 - Vendor: Novagen; Vector Type: Insect expression; Sequencing Primer: T7; Bacteria Resistance: Ampicillin



Copyright 2005 BVTech, Inc. All Rights Reserved

Search plasmid maps in this site
Google
Web biovisualtech.com
More Plasmid Map Templates
  • Insect expression
  • Bacterial expression
  • Cre/Lox
  • Insect expression
  • Lentiviral
  • Luciferase
  • Mammalian expression
  • Other
  • Retroviral
  • RNAi
  • Worm expression
  • Yeast expression
  • Bacterial vectors
  • Mammalian
  • Recent Release from EMBL

  • Free Software Downloads
    BVTech Photo Publisher
    Help you publish your pictures over the Internet or a local network so that other people can view them in their Web browsers
    HealthWatch
    A virtual apple a day to keep the doctor away
    Download VisualSniffer 2.0
    VisualSniffer is a powerful packet capture tool and protocol analyzer
    BVTech Plasmid
    A plasmid drawing software