|
|
Download the plasmid map
Use BVTech Plasmid to view and edit this plasmid map.
Dowload BVTech Plasmid
If you do not have BVTech Plasmid, download the latest version of BVTech Plasmid here.
BVTech Plasmid is DNA sequence analysis and plasmid drawing software for Windows PCs.
You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your
DNA sequencing data, align sequences, and much more.
Free to try, $39.98 to buy
Payments will be processed by PayPal. PayPal is the safer, easier way to pay.
|
View the sequence with features on line LL-hNANOGi Gene/insert name: NANOG - RNAi Alternative names: Nanog Insert size (bp): 55 Gene/insert aliases: NANOG Species of gene(s): H. sapiens (human) Vector backbone: pLL3.7 (Search Vector Database) Type of vector: Mammalian expression,Lentiviral,RNAi,Cre/Lox Backbone size (bp): 7650 Cloning site 5': HpaI Site destroyed during cloning: Yes Cloning site 3': XhoI Site destroyed during cloning: No 5' Sequencing primer: n/a (List of Sequencing Primers) Bacteria resistance: Ampicillin High or low copy: High Copy Grow in standard E. coli @ 37C: Yes Plasmid Provided In: DH5a Principal Investigator: George Q Daley Comments: Target sequence: GGGTTAAGCTGTAACATACTT (NM_024865: bp 1857-1877) Article: High-efficiency RNA interference in human embryonic stem cells. Zaehres H et al. (Stem Cells. 2005 Mar . 23(3):299-305. Pubmed)
|