Download the plasmid map Use BVTech Plasmid to view and edit this plasmid map. Dowload BVTech Plasmid If you do not have BVTech Plasmid, download the latest version of BVTech Plasmid here. BVTech Plasmid is DNA sequence analysis and plasmid drawing software for Windows PCs. You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your DNA sequencing data, align sequences, and much more. Free to try, $39.98 to buy Payments will be processed by PayPal. PayPal is the safer, easier way to pay.

View the sequence with features on line
LL-hOCT4i-1
Gene/insert name: OCT4 - RNAi
Alternative names: Oct4
Insert size (bp): 55
Gene/insert aliases: POU5F1, OCT3, OCT4, OTF3, OTF4, MGC22487
Species of gene(s): H. sapiens (human)
Vector backbone: pLL3.7 (Search Vector Database)
Type of vector: Mammalian expression,Lentiviral,RNAi,Cre/Lox
Backbone size (bp): 7650
Cloning site 5': HpaI
Site destroyed during cloning: Yes
Cloning site 3': XhoI
Site destroyed during cloning: No
5' Sequencing primer: n/a (List of Sequencing Primers)
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
Sequence: View sequence
Plasmid Provided In: DH5a
Principal Investigator: George Q Daley
Comments: Target sequence: CATGTGTAAGCTGCGGCCCTT (NM_002701: bp 642-662)
Article: High-efficiency RNA interference in human embryonic stem cells. Zaehres H et al. (Stem Cells. 2005 Mar . 23(3):299-305. Pubmed)