image of the BVTech Plasmid
Search plasmid maps in this site
More Plasmid Map Templates
  • Adenoviral
  • Bacterial expression
  • Cre/Lox
  • Insect expression
  • Lentiviral
  • Luciferase
  • Mammalian expression
  • Other
  • Retroviral
  • RNAi
  • Worm expression
  • Yeast expression
  • Bacterial vectors
  • Mammalian
  • Recent Release from EMBL
  • Free Software Downloads
    BVTech Photo Publisher
    Help you publish your pictures over the Internet or a local network so that other people can view them in their Web browsers
    A virtual apple a day to keep the doctor away
    Download VisualSniffer 2.0
    VisualSniffer is a powerful packet capture tool and protocol analyzer
    BVTech Plasmid
    A plasmid drawing software
    Download Growth Chart SDK to integrate the functionality of Growth Charts from HealthWatch Pro into your business applications

    Plasmid map of LL-hOCT4i-1

    Download the plasmid map
    Use BVTech Plasmid to view and edit this plasmid map.

    Dowload BVTech Plasmid
    If you do not have BVTech Plasmid, download the latest version of BVTech Plasmid here.

    BVTech Plasmid is DNA sequence analysis and plasmid drawing software for Windows PCs. You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your DNA sequencing data, align sequences, and much more.

    Free to try, $39.98 to buy

    Payments will be processed by PayPal. PayPal is the safer, easier way to pay.

    View the sequence with features on line
    Gene/insert name: OCT4 - RNAi
    Alternative names: Oct4
    Insert size (bp): 55
    Gene/insert aliases: POU5F1, OCT3, OCT4, OTF3, OTF4, MGC22487
    Species of gene(s): H. sapiens (human)
    Vector backbone: pLL3.7 (Search Vector Database)
    Type of vector: Mammalian expression,Lentiviral,RNAi,Cre/Lox
    Backbone size (bp): 7650
    Cloning site 5': HpaI
    Site destroyed during cloning: Yes
    Cloning site 3': XhoI
    Site destroyed during cloning: No
    5' Sequencing primer: n/a (List of Sequencing Primers)
    Bacteria resistance: Ampicillin
    High or low copy: High Copy
    Grow in standard E. coli @ 37C: Yes
    Sequence: View sequence
    Plasmid Provided In: DH5a
    Principal Investigator: George Q Daley
    Comments: Target sequence: CATGTGTAAGCTGCGGCCCTT (NM_002701: bp 642-662)
    Article: High-efficiency RNA interference in human embryonic stem cells. Zaehres H et al. (Stem Cells. 2005 Mar . 23(3):299-305. Pubmed)

    image of LL-hOCT4i-1

    Copyright 2005 BVTech, Inc. All Rights Reserved