image of the BVTech Plasmid

Luciferase Plasmids


FHRE-Luc to pAG184_NEK6 | pAG193_CORO1C to PGC-1-luciferase | pIS0 to pRL-TK_CXCR4_2x | 

All plasmid maps listed here are created using BVTech Plasmid. If you do not have BVTech Plasmid, Click here to download the latest version of BVTech Plasmid

BVTech Plasmid is DNA sequence analysis and plasmid drawing software for Windows PCs.You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your DNA sequencing data, align sequences, and much more.

Free to try, $39.98 to buy

Payments will be processed by PayPal. PayPal is the safer, easier way to pay.

Plasmids 0 - 4Descriptions
small image of FHRE-LucFHRE-Luc - Gene/insert name: FHRE; Alternative names: FKHRL1; FOXO3a; forkhead responsive element; Gene/insert aliases: FOXO3, FOXO2, AF6q21, FKHRL1, FOXO3A, FKHRL1P2, MGC12739, MGC31925, DKFZp781A0677; Species of gene(s): H. sapiens (human); Relevant mutations/deletions: 3 copies of FRE; Vector backbone: pGL3 basic (Search Vector Database); Backbone manufacturer: Promega; Cloning site 5'':...
small image of pAG142_TNS3pAG142 TNS3 3'UTR - Gene/insert name: N7 3'UTR; Alternative names: TNS3; Tensin 3; GenBank/Entrez ID of insert: NM_022748; Species of gene(s): H. sapiens (human); Vector backbone: pIS2 (Search Vector Database); Backbone manufacturer: pIS2 derived from pRL-SV40 (Promega); Cloning site 5': SacI; Site destroyed during cloning: No; Cloning site 3': SpeI; Site destroyed during cloning: No...
small image of pAG143_AK024929pAG143 AK024929 3'UTR - Gene/insert name: N8 3'UTR; GenBank/Entrez ID of insert: AK024929; Species of gene(s): H. sapiens (human); Vector backbone: pIS2 (Search Vector Database); Backbone manufacturer: pIS2 derived from pRL-SV40 (Promega); Cloning site 5': SacI; Site destroyed during cloning: No; Cloning site 3': SpeI; Site destroyed during cloning: No; 5' Sequencing primer: EBV re...
small image of pAG147_BC072452pAG147 BC072452 3'UTR - Gene/insert name: N12 3'UTR; GenBank/Entrez ID of insert: BC072452; Species of gene(s): H. sapiens (human); Vector backbone: pIS2 (Search Vector Database); Backbone manufacturer: pIS2 derived from pRL-SV40 (Promega); Cloning site 5': SacI; Site destroyed during cloning: No; Cloning site 3': NheI; Site destroyed during cloning: No; 5' Sequencing primer: EBV r...
small image of pAG184_NEK6pAG184 NEK6 3'UTR - Gene/insert name: N17 3'UTR; Alternative names: NEK6; GenBank/Entrez ID of insert: NM_014397; Gene/insert aliases: NEK6, SID6-1512; Species of gene(s): H. sapiens (human); Vector backbone: pIS2 (Search Vector Database); Backbone manufacturer: pIS2 derived from pRL-SV40 (Promega); Cloning site 5': SacI; Site destroyed during cloning: No; Cloning site 3': SpeI; Site d...

Plasmids 5 - 9Descriptions
small image of pAG193_CORO1CpAG193 CORO1C 3'UTR - Gene/insert name: CORO1C 3'UTR; Alternative names: CORO1C; GenBank/Entrez ID of insert: NM_014325; Gene/insert aliases: CORO1C, HCRNN4; Species of gene(s): H. sapiens (human); Vector backbone: pIS2 (Search Vector Database); Backbone manufacturer: pIS2 derived from pRL-SV40 (Promega); Cloning site 5': SacI; Site destroyed during cloning: No; Cloning site 3': SpeI...
small image of pBV-LucpBV-Luc - Gene/insert name: None; Fusion proteins or tags: Luciferase; Terminal: C terminal on backbone; Vector backbone: pBV-Luc (Search Vector Database); Backbone manufacturer: Vogelstein Lab; Cloning site 5': See map; Site destroyed during cloning: No; Cloning site 3': See map; Site destroyed during cloning: No; 5' Sequencing primer: RVprimer3 (List of Sequencing Primers); 3' Sequencin...
small image of PGC-1PGC-1 alpha promoter luciferase delta MEF - Gene/insert name: PGC-1 alpha promoter dMEF; Alternative names: PGC1 promoter; PGC-1a promoter; Gene/insert aliases: Ppargc1a, Pgc1, PGC-1, Pgco1, PGC-1v, Ppargc1, Pgc-1alpha, A830037N07Rik; Species of gene(s): M. musculus (mouse); Relevant mutations/deletions: Site-directed mutagenesis to remove the MEF2 binding site.; Fusion proteins or tags: luciferase...
small image of PGC-1-CrePGC-1 alpha promoter luciferase delta CRE - Gene/insert name: PGC-1 alpha promoter dCRE; Alternative names: PGC1 promoter; PGC-1a promoter; Gene/insert aliases: Ppargc1a, Pgc1, PGC-1, Pgco1, PGC-1v, Ppargc1, Pgc-1alpha, A830037N07Rik; Species of gene(s): M. musculus (mouse); Relevant mutations/deletions: Site-directed mutagenesis to remove the CREB binding site.; Fusion proteins or tags: lucife...
small image of PGC-1-luciferasePGC-1 alpha promoter 2kb luciferase - Gene/insert name: PGC-1 alpha promoter; Alternative names: PGC1 promoter; PGC-1a promoter; Gene/insert aliases: Ppargc1a, Pgc1, PGC-1, Pgco1, PGC-1v, Ppargc1, Pgc-1alpha, A830037N07Rik; Species of gene(s): M. musculus (mouse); Fusion proteins or tags: luciferase; Terminal: C terminal on backbone; Vector backbone: pGL3-basic (Search Vector Database...

Plasmids 10 - 14Descriptions
small image of pIS0Vector backbone: pIS0 - Backbone manufacturer: Bartel Lab ; 5' Sequencing primer: n/a ; 3' Sequencing primer: EBV rev primer (GTGGTTTGTCCAAACTCATC) ; Bacteria resistance: Ampicillin ; High or low copy: High Copy ; Grow in standard E. coli @ 37C: Yes ; Plasmid Provided In: DH5a ; Principal Investigator: David Bartel ; Comments: The firefly luciferase vector was modified fr...
small image of pIS1Vector backbone: pIS1 - Backbone manufacturer: Bartel Lab ; 5' Sequencing primer: n/a ; 3' Sequencing primer: EBV rev primer (GTGGTTTGTCCAAACTCATC) ; Bacteria resistance: Ampicillin ; High or low copy: High Copy ; Grow in standard E. coli @ 37C: Yes ; Plasmid Provided In: DH5a ; Principal Investigator: David Bartel ; Comments: pIS1 was derived from pRL-TK by adding more c...
small image of pIS2Vector backbone: pIS2 - Backbone manufacturer: David Bartel Lab ; 5' Sequencing primer: EBV rev primer (GTGGTTTGTCCAAACTCATC) (List of Sequencing Primers) ; Bacteria resistance: Ampicillin ; High or low copy: High Copy ; Grow in standard E. coli @ 37C: Yes ; Plasmid Provided In: DH5a ; Principal Investigator: David Bartel ; Comments: pIS2 was derived from pRL-SV40. More cloni...
small image of pRL-TK CXCR4 2xpRL-TK CXCR4 2x - Gene/insert name: 2 bulged bind sites for CXCR4 siRNA antisense ; Fusion proteins or tags: Rr-luc ; Terminal: N terminal on backbone ; Vector backbone: pRL-TK ; Backbone manufacturer: Promega ; Cloning site 5': XbaI ; Site destroyed during cloning: No ; Cloning site 3': ApaI ; Site destroyed during cloning: No ; 5' Sequencing primer: See map ; 3...
small image of pRL-TK_CXCR4_2xpRL-TK CXCR4 2x - Gene/insert name: 2 bulged bind sites for CXCR4 siRNA antisense; Fusion proteins or tags: Rr-luc; Terminal: N terminal on backbone; Vector backbone: pRL-TK (Search Vector Database); Backbone manufacturer: Promega; Cloning site 5': XbaI; Site destroyed during cloning: No; Cloning site 3': ApaI; Site destroyed during cloning: No; 5' Sequencing primer: See map (List...



Copyright 2005 BVTech, Inc. All Rights Reserved

Search plasmid maps in this site
Google
Web biovisualtech.com
More Plasmid Map Templates
  • Luciferase
  • Bacterial expression
  • Cre/Lox
  • Insect expression
  • Lentiviral
  • Luciferase
  • Mammalian expression
  • Other
  • Retroviral
  • RNAi
  • Worm expression
  • Yeast expression
  • Bacterial vectors
  • Mammalian
  • Recent Release from EMBL

  • Free Software Downloads
    BVTech Photo Publisher
    Help you publish your pictures over the Internet or a local network so that other people can view them in their Web browsers
    HealthWatch
    A virtual apple a day to keep the doctor away
    Download VisualSniffer 2.0
    VisualSniffer is a powerful packet capture tool and protocol analyzer
    BVTech Plasmid
    A plasmid drawing software