BV Tech Plasmid
Plasmid drawing software

Luciferase Plasmids

  • pRL-TK CXCR4 2x
    Gene/insert name: 2 bulged bind sites for CXCR4 siRNA antisense
    Insert size (bp): 69
    Fusion proteins or tags: Rr-luc
    Terminal: N terminal on backbone
    Vector backbone: pRL-TK
    Backbone manufacturer: Promega
    Type of vector: Luciferase
    Backbone size (bp): 4045
    Cloning site 5': XbaI
    Site destroyed during cloning: No
    Cloning site 3': ApaI
    Site destroyed during cloning: No
    5' Sequencing primer: See map
    3' Sequencing primer: EBV-rev
    Bacteria resistance: Ampicillin
    High or low copy: High Copy
    Grow in standard E. coli @ 37C: Yes
    Principal Investigator: Phil Sharp
    Comments: The end of the ORF and the beginning of the 3' UTR is (with the TAA stop codon, followed by T, then the XbaI site TCTAGA): AAATGAACAA TAA T TCTAGA GCGGCCGCT.
    Article: siRNAs can function as miRNAs. Doench JG et al. (Genes Dev. 2003 Feb 15. 17(4):438-42. Pubmed)
  • pIS2
    Vector backbone: pIS2
    Backbone manufacturer: David Bartel Lab
    Type of vector: Mammalian expression,Luciferase
    Backbone size (bp): 3745
    5' Sequencing primer: EBV rev primer (GTGGTTTGTCCAAACTCATC) (List of Sequencing Primers)
    Bacteria resistance: Ampicillin
    High or low copy: High Copy
    Grow in standard E. coli @ 37C: Yes
    Plasmid Provided In: DH5a
    Principal Investigator: David Bartel
    Comments: pIS2 was derived from pRL-SV40. More cloning sites have been added (the lower case is the pRL-SV40 and the caps is the new sequence that has been inserted): gaacaataattctagGAGCTCTATACCGGTCT CGATATCACTACTAGTGTtctagagcggccgc t . The plasmid contains a renilla luciferase reporter driven by the SV40 early enhancer/promoter.
    Article: The widespread impact of mammalian MicroRNAs on mRNA repression and evolution. Farh KK et al. (Science. 2005 Dec 16. 310(5755):1817-21. Pubmed)
  • pIS1
    Vector backbone: pIS1
    Backbone manufacturer: Bartel Lab
    Type of vector: Mammalian expression,Luciferase
    Backbone size (bp): 4085
    5' Sequencing primer: n/a
    3' Sequencing primer: EBV rev primer (GTGGTTTGTCCAAACTCATC)
    Bacteria resistance: Ampicillin
    High or low copy: High Copy
    Grow in standard E. coli @ 37C: Yes
    Plasmid Provided In: DH5a
    Principal Investigator: David Bartel
    Comments: pIS1 was derived from pRL-TK by adding more cloning sites. The plasmid contains a renilla luciferase reporter driven by the HSV TK promoter. Search Addgene's vector database for more information on pRL-TK from Promega.
  • pIS0
    Vector backbone: pIS0
    Backbone manufacturer: Bartel Lab
    Type of vector: Mammalian expression,Luciferase
    Backbone size (bp): 5264
    5' Sequencing primer: n/a
    3' Sequencing primer: EBV rev primer (GTGGTTTGTCCAAACTCATC)
    Bacteria resistance: Ampicillin
    High or low copy: High Copy
    Grow in standard E. coli @ 37C: Yes
    Plasmid Provided In: DH5a
    Principal Investigator: David Bartel
    Comments: The firefly luciferase vector was modified from pGL3 Control Vector (Promega), such that a short sequence containing multiple cloning sites (5'-AGCTCTATACGCGTCTCAAGCTTACTGCTAGC GT-3') was inserted into the XbaI site immediately downstream from the stop codon. 3'UTR segments of target genes can be inserted into this vector to test for their effects on mRNA stability.
    Article: MicroRNA-directed cleavage of HOXB8 mRNA. Yekta S et al. (Science. 2004 Apr 23. 304(5670):594-6. Pubmed)



  • Copyright 2005 BVTech, Inc. All Rights Reserved

    Search
    Google
    Web biovisualtech.com
    Free Software Downloads
    BVTech Photo Publisher
    Help you publish your pictures over the Internet or a local network so that other people can view them in their Web browsers
    HealthWatch
    A virtual apple a day to keep the doctor away
    Download VisualSniffer 2.0
    VisualSniffer is a powerful packet capture tool and protocol analyzer
    BVTech Plasmid
    A plasmid drawing software