Luciferase Plasmids
|
|
pRL-TK CXCR4 2x
Gene/insert name: 2 bulged bind sites for CXCR4 siRNA antisense
Insert size (bp): 69
Fusion proteins or tags: Rr-luc
Terminal: N terminal on backbone
Vector backbone: pRL-TK
Backbone manufacturer: Promega
Type of vector: Luciferase
Backbone size (bp): 4045
Cloning site 5': XbaI
Site destroyed during cloning: No
Cloning site 3': ApaI
Site destroyed during cloning: No
5' Sequencing primer: See map
3' Sequencing primer: EBV-rev
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
Principal Investigator: Phil Sharp
Comments: The end of the ORF and the beginning of the 3' UTR is (with the TAA stop codon, followed by T, then the XbaI site
TCTAGA): AAATGAACAA TAA T TCTAGA GCGGCCGCT.
Article: siRNAs can function as miRNAs. Doench JG et al. (Genes Dev. 2003 Feb 15. 17(4):438-42. Pubmed)
pIS2
Vector backbone: pIS2
Backbone manufacturer: David Bartel Lab
Type of vector: Mammalian expression,Luciferase
Backbone size (bp): 3745
5' Sequencing primer: EBV rev primer (GTGGTTTGTCCAAACTCATC) (List of Sequencing Primers)
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
Plasmid Provided In: DH5a
Principal Investigator: David Bartel
Comments: pIS2 was derived from pRL-SV40. More cloning sites have been added (the lower case is the pRL-SV40 and the caps is the new sequence that has been inserted): gaacaataattctagGAGCTCTATACCGGTCT CGATATCACTACTAGTGTtctagagcggccgc t . The plasmid contains a renilla luciferase reporter driven by the SV40 early enhancer/promoter.
Article: The widespread impact of mammalian MicroRNAs on mRNA repression and evolution. Farh KK et al. (Science. 2005 Dec 16. 310(5755):1817-21. Pubmed)
pIS1
Vector backbone: pIS1
Backbone manufacturer: Bartel Lab
Type of vector: Mammalian expression,Luciferase
Backbone size (bp): 4085
5' Sequencing primer: n/a
3' Sequencing primer: EBV rev primer (GTGGTTTGTCCAAACTCATC)
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
Plasmid Provided In: DH5a
Principal Investigator: David Bartel
Comments: pIS1 was derived from pRL-TK by adding more cloning sites. The plasmid contains a renilla luciferase reporter driven by
the HSV TK promoter. Search Addgene's vector database for more information on pRL-TK from Promega.
pIS0
Vector backbone: pIS0
Backbone manufacturer: Bartel Lab
Type of vector: Mammalian expression,Luciferase
Backbone size (bp): 5264
5' Sequencing primer: n/a
3' Sequencing primer: EBV rev primer (GTGGTTTGTCCAAACTCATC)
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
Plasmid Provided In: DH5a
Principal Investigator: David Bartel
Comments: The firefly luciferase vector was modified from pGL3 Control Vector (Promega), such that a short sequence containing
multiple cloning sites (5'-AGCTCTATACGCGTCTCAAGCTTACTGCTAGC GT-3') was inserted into the XbaI site immediately downstream from the
stop codon. 3'UTR segments of target genes can be inserted into this vector to test for their effects on mRNA stability.
Article: MicroRNA-directed cleavage of HOXB8 mRNA. Yekta S et al. (Science. 2004 Apr 23. 304(5670):594-6. Pubmed)
|
|
|
|
Copyright 2005 BVTech, Inc. All Rights Reserved
|
|
|
|
|
|