BV Tech Plasmid
Plasmid drawing software

Plasmid map of MDH1-PGK-GFP_2.0

Gene/insert name: None
Insert size (bp): Unknown
Vector backbone: MDH1-PGK-GFP 2.0
Type of vector: Mammalian expression,Retroviral,RNAi
Backbone size (bp): 6963
5' Sequencing primer: EGFP-C
3' Sequencing primer: ggatcccaatatttgcatgtcgc
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
Plasmid Provided In: DH5a
Principal Investigator: Chang-Zheng Chen
Article: MicroRNAs modulate hematopoietic lineage differentiation. Chen CZ et al. (Science. 2004 Jan 2. 303(5654):83-6. Pubmed)

Download plasmid map



image of the Plasmid



Copyright 2005 BVTech, Inc. All Rights Reserved

Search
Google
Web biovisualtech.com
Free Software Downloads
BVTech Photo Publisher
Help you publish your pictures over the Internet or a local network so that other people can view them in their Web browsers
HealthWatch
A virtual apple a day to keep the doctor away
Download VisualSniffer 2.0
VisualSniffer is a powerful packet capture tool and protocol analyzer
BVTech Plasmid
A plasmid drawing software


Download Growth Chart SDK to integrate the functionality of Growth Charts from HealthWatch Pro into your business applications