image of the BVTech Plasmid

Mammalian Plasmids


pEXP1-DEST_(Expressway_in_vitro) to pEYFP-N1 | pFB-Luc_(ViraPort) to pGene_V5-His_C_(GeneSwitch) | pGeneClip_Basic to pGeneClip_Puromycin | pGlow_TOPO to phrG-B | phRG-TK to phRL-TK | phRL-TK(Int-) to pIRES2-EGFP | pIRESbleo3 to pIRESpuro3 | 

All plasmid maps listed here are created using BVTech Plasmid. If you do not have BVTech Plasmid, Click here to download the latest version of BVTech Plasmid

BVTech Plasmid is DNA sequence analysis and plasmid drawing software for Windows PCs.You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your DNA sequencing data, align sequences, and much more.

Free to try, $39.98 to buy

Payments will be processed by PayPal. PayPal is the safer, easier way to pay.

Plasmids 0 - 4Descriptions
small image of pEXP1-DEST_(Expressway_in_vitro)pEXP1-DEST (Expressway in vitro) - Vendor:Invitrogen; Vector Type: In vitro; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, Xpress (Nterm); Bacteria Resistance: N/a; Mammalian Selection: Zeocin; Catalog Number: V96001
small image of pEXP2-DEST_(Expressway_in_vitro)pEXP2-DEST (Expressway in vitro) - Vendor:Invitrogen; Vector Type: In vitro; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, Xpress (Cterm); Bacteria Resistance: N/a; Mammalian Selection: Zeocin; Catalog Number: V96002
small image of pEYFP-1pEYFP-1 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: No promoter; Promoter: none; Sequencing Primer: EGFP-N; Sequencing Primer Sequence: 5'd[CGTCGCCGTCCAGCTCGACCAG]3'; Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 6007-1; Comments:Yellow variant of GFP reporter. Used to monitor transcriptio...
small image of pEYFP-C1pEYFP-C1 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: Constitutive; Promoter: CMV; Sequencing Primer: EGFP-C; Sequencing Primer Sequence: 5'd[CATGGTCCTGCTGGAGTTCGTG]; Tag: EYFP (Nterm); Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 6006-1; Comments:Yellow variant of GFP tag
small image of pEYFP-N1pEYFP-N1 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: Constitutive; Promoter: CMV; Sequencing Primer: EGFP-N; Sequencing Primer Sequence: 5'd[CGTCGCCGTCCAGCTCGACCAG]3'; Tag: EYFP (Cterm); Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 6006-1; Comments:Yellow variant of GFP tag

Plasmids 5 - 9Descriptions
small image of pFB-Luc_(ViraPort)pFB-Luc (ViraPort) - Vendor:Stratagene; Vector Type: Mammalian; Viral/Non-viral: Viral; Stable/Transient: Stable (retroviral); Constitutive/Inducible: Constitutive; Bacteria Resistance: Ampicillin; Catalog Number: 240030; Comments:Retroviral vector containing luciferase, useful for optimizing transfection efficiency.
small image of pFB-Neo_(ViraPort)pFB-Neo (ViraPort) - Vendor:Stratagene; Vector Type: Mammalian; Viral/Non-viral: Viral; Stable/Transient: Stable (retroviral); Constitutive/Inducible: Constitutive; Bacteria Resistance: Ampicillin; Mammalian Selection: neo; Catalog Number: 217561; Comments:Retroviral expression vector that is selectable; must co-transfect with gag-pol & env protein
small image of pGene_V5-His_A_(GeneSwitch)pGene/V5-His A (GeneSwitch) - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Inducible; Promoter: Gal4-E1b; Expression Level: Tightly controlled (activate with mifepristone); Sequencing Primer: pGene Fwd; Sequencing Primer Sequence: 5'd[CTGCTATTCTGCTCAACCT]3'; Tag: 6X His, V5; Bacteria Resistance: Ampicillin; Mammal...
small image of pGene_V5-His_B_(GeneSwitch)pGene/V5-His B (GeneSwitch) - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Inducible; Promoter: Gal4-E1b; Expression Level: Tightly controlled (activate with mifepristone); Sequencing Primer: pGene Fwd; Sequencing Primer Sequence: 5'd[CTGCTATTCTGCTCAACCT]3'; Tag: 6X His, V5; Bacteria Resistance: Ampicillin; Mammal...
small image of pGene_V5-His_C_(GeneSwitch)pGene/V5-His C (GeneSwitch) - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Inducible; Promoter: Gal4-E1b; Expression Level: Tightly controlled (activate with mifepristone); Sequencing Primer: pGene Fwd; Sequencing Primer Sequence: 5'd[CTGCTATTCTGCTCAACCT]3'; Tag: 6X His, V5; Bacteria Resistance: Ampicillin; Mammal...

Plasmids 10 - 14Descriptions
small image of pGeneClip_BasicpGeneClip Basic - Vendor:Promega; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Bacteria Resistance: Ampicillin; Catalog Number: C8750; GenBank Accession Number:AY744385
small image of pGeneClip_hMGFPpGeneClip hMGFP - Vendor:Promega; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Tag: GFP; Bacteria Resistance: Ampicillin; Catalog Number: C8790; GenBank Accession Number:AY744386; Comments:Hairpin cloning system
small image of pGeneClip_HygromycinpGeneClip Hygromycin - Vendor:Promega; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Bacteria Resistance: Ampicillin; Mammalian Selection: Hygromycin; Catalog Number: C8770; GenBank Accession Number:AY745745; Comments:Hairpin cloning system; unique drug resistance
small image of pGeneClip_NeomycinpGeneClip Neomycin - Vendor:Promega; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Bacteria Resistance: Ampicillin; Mammalian Selection: G418; Catalog Number: C8780; GenBank Accession Number:AY745746; Comments:Hairpin cloning system; unique drug resistance
small image of pGeneClip_PuromycinpGeneClip Puromycin - Vendor:Promega; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Bacteria Resistance: Ampicillin; Mammalian Selection: Puromycin; Catalog Number: C8760; GenBank Accession Number:AY745747; Comments:Hairpin cloning system; unique drug resistance

Plasmids 15 - 19Descriptions
small image of pGlow_TOPOpGlow TOPO - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Bacteria Resistance: Ampicillin; Mammalian Selection: G418; Catalog Number: K483001; Comments:Drives GFP expression
small image of pHcRed1-1pHcRed1-1 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: No promoter; Promoter: none; Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 632411; Comments:Far-red fluorescent reporter. Used to monitor transcription on cis-regulatory elements.
small image of pHcRed1-C1pHcRed1-C1 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: Constitutive; Promoter: CMV; Tag: HcRed1 (Nterm); Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 632415; Comments:HcRed1 tag, far-red fluorescent protein
small image of pHcRed1-N1_1pHcRed1-N1/1 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: Constitutive; Promoter: CMV; Tag: HcRed1 (Cterm); Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 632424; Comments:HcRed1 tag, far-red fluorescent protein
small image of phrG-BphrG-B - Vendor:Promega; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: n/a; Bacteria Resistance: Ampicillin; Catalog Number: E6281; GenBank Accession Number:AF362550; Comments:Renilla luciferase reporter

Plasmids 20 - 24Descriptions
small image of phRG-TKphRG-TK - Vendor:Promega; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: n/a; Bacteria Resistance: Ampicillin; Catalog Number: E6291; GenBank Accession Number:AF362551; Comments:Renilla luciferase reporter
small image of phRL-CMVphRL-CMV - Vendor:Promega; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: n/a; Bacteria Resistance: Ampicillin; Catalog Number: E6271; GenBank Accession Number:AF362549; Comments:Renilla luciferase reporter
small image of phRL-nullphRL-null - Vendor:Promega; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: n/a; Bacteria Resistance: Ampicillin; Catalog Number: E6231; GenBank Accession Number:AF362546; Comments:Renilla luciferase reporter
small image of phRL-SV40phRL-SV40 - Vendor:Promega; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: SV40; Expression Level: High; Sequencing Primer: n/a; Bacteria Resistance: Ampicillin; Catalog Number: E6261; GenBank Accession Number:AF362548; Comments:Renilla luciferase reporter
small image of phRL-TKphRL-TK - Vendor:Promega; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: HSV-TK; Expression Level: High; Sequencing Primer: n/a; Bacteria Resistance: Ampicillin; Catalog Number: E6241; GenBank Accession Number:AF362545; Comments:Renilla luciferase reporter

Plasmids 25 - 29Descriptions
small image of phRL-TK(Int-)phRL-TK(Int-) - Vendor:Promega; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: HSV-TK; Expression Level: High; Sequencing Primer: n/a; Bacteria Resistance: Ampicillin; Catalog Number: E6251; GenBank Accession Number:AF362547; Comments:Renilla luciferase reporter
small image of pIRESpIRES - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: Constitutive; Promoter: CMV; Tag: IRES; Bacteria Resistance: Ampicillin; Mammalian Selection: Neomycin; Catalog Number: 631605; Comments:Express 2 genes on one transcript with IRES
small image of pIRES2-DsRed2pIRES2-DsRed2 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: Constitutive; Promoter: CMV; Tag: IRES-DsRed2; Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 632420; Comments:Express a gene and DsRed2 on one transcript
small image of pIRES2-DsRed-ExpresspIRES2-DsRed-Express - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: Constitutive; Promoter: CMV; Tag: IRES-DsRed; Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 632463; Comments:Express a gene and DsRed on one transcript
small image of pIRES2-EGFPpIRES2-EGFP - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: Constitutive; Promoter: CMV; Tag: IRES-EGFP; Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 6029-1; Comments:Express a gene and EGFP on one transcript

Plasmids 30 - 34Descriptions
small image of pIRESbleo3pIRESbleo3 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: Constitutive; Promoter: CMV; Tag: IRES-Bleo; Bacteria Resistance: Ampicillin; Mammalian Selection: Zeocin; Catalog Number: 631622; Comments:Stably select with bleomycin, phleomycin, or zeocin
small image of pIREShyg3pIREShyg3 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: Constitutive; Promoter: CMV; Tag: IRES-hygromycin; Bacteria Resistance: Ampicillin; Mammalian Selection: Hygromycin; Catalog Number: 631620; Comments:Stably select with hygromycin
small image of pIRESpuro3pIRESpuro3 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: Constitutive; Promoter: CMV; Tag: IRES-puromycin; Bacteria Resistance: Ampicillin; Mammalian Selection: Puromycin; Catalog Number: 631619; Comments:Stably select with puromycin



Copyright 2005 BVTech, Inc. All Rights Reserved

Search plasmid maps in this site
Google
Web biovisualtech.com
More Plasmid Map Templates
  • Mammalian
  • Bacterial expression
  • Cre/Lox
  • Insect expression
  • Lentiviral
  • Luciferase
  • Mammalian expression
  • Other
  • Retroviral
  • RNAi
  • Worm expression
  • Yeast expression
  • Bacterial vectors
  • Mammalian
  • Recent Release from EMBL

  • Free Software Downloads
    BVTech Photo Publisher
    Help you publish your pictures over the Internet or a local network so that other people can view them in their Web browsers
    HealthWatch
    A virtual apple a day to keep the doctor away
    Download VisualSniffer 2.0
    VisualSniffer is a powerful packet capture tool and protocol analyzer
    BVTech Plasmid
    A plasmid drawing software