image of the BVTech Plasmid

Mammalian expression Plasmids


Friend MLV Env YFP to pAcGFP1-C1 | pAcGFP1-N1 to pAmCyan1-C1 | pAmCyan1-N1 to pBABE-neo | pbgal-Basic to pBigT | pBIND to pCAGIG | pCAT3-Basic to pcDNA_DEST40 | pcDNA3.1(-) to pcDNA3.1(+)_myc-His_C | pcDNA3.1_CT-GFP_Fusion to pcDNA3.1_Hygro(-) | pcDNA3.1_Hygro(+) to pcDNA3.1_Zeo(+) | pcDNA3.1D_V5-His-TOPO to pcDNA4_His_C | pcDNA4_His-Max_A to pcDNA4_myc-His_B | pcDNA4_myc-His_C to pcDNA5_FRT_TO | pcDNA5_FRT_TO-E to pcDNA6.2_V5-GW_Directional_TOPO | pcDNA6_BioEase-DEST to pcDNA6_myc-His_A | pcDNA6_myc-His_B to pCMV_myc_cyto | pCMV_myc_ER to pCMV-Myc | pCMV-Script to pCX4pur | pCXneo to pDNR-CMV | pDRIVE-CAG to pDsRed-Express-1 | pDsRed-Express-C1 to pECFP-C1 | pECFP-N1 to pEF1_myc-His_A | pEF1_myc-His_B to pEF1_V5_His_C | pEF4_His_A to pEF4_myc-His_B | pEF4_myc-His_C to pEF5_FRT_V5_DEST_Gateway | pEF5_FRT_V5_D-TOPO to pEF6_His_C | pEF6_myc-His_A to pEF-GFP | pEGFP-1 to pEGFP-N3 | pIRESneo3 to pST1374 | 

All plasmid maps listed here are created using BVTech Plasmid. If you do not have BVTech Plasmid, Click here to download the latest version of BVTech Plasmid

BVTech Plasmid is DNA sequence analysis and plasmid drawing software for Windows PCs.You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your DNA sequencing data, align sequences, and much more.

Free to try, $39.98 to buy

Payments will be processed by PayPal. PayPal is the safer, easier way to pay.

Plasmids 0 - 4Descriptions
small image of Friend MLV Env YFPFriend MLV Env YFP - Gene/insert name: Envelope ; Alternative names: Env, FrMLVgp3 ; Gene/insert aliases: env ; Species of gene(s): MuLV ; Fusion proteins or tags: EYFP ; Vector backbone: pcDNA3; Cloning site 5': ? ; Site destroyed during cloning: Don't Know ; Cloning site 3': ? ; Site destroyed during cloning: Don't Know ; 5' Sequencing primer: T7 ; 3' S...
small image of JP1520JP1520 - Vendor: Harvard Institute of Proteomics; Vector Type: Mammalian expression; Viral/Non-viral: Retroviral; Bacteria Resistance: Ampicillin; Mammalian Selection: Puromycin; Comments: Made by J. Pearlberg at HIP. Includes loxP site for recombinational cloning.
small image of Lamp1-RFPLamp1-RFP - Gene/insert name: lysosome associated membrane protein 1 ; Alternative names: Lamp-1 ; Gene/insert aliases: Lamp1, LGP120 ; Species of gene(s): R. norvegicus (rat) ; Fusion proteins or tags: RFP ; Terminal: C terminal on backbone ; Vector backbone: Modified Clontech Plasmid; Cloning site 5': EcoRI ; Site destroyed during cloning: No ; Cloning site 3'...
small image of p70-S6-kinaseGene/insert name: p70 alpha1 S6 kinase - Alternative names: p70 S6 kinase ; Gene/insert aliases: Rps6kb1 ; Species of gene(s): R. norvegicus (rat); Fusion proteins or tags: HA ; Terminal: N terminal on insert ; Vector backbone: PMT2 (Search Vectorpedia) ; Cloning site 5': EcoRI ; Site destroyed during cloning: No ; Cloning site 3': EcoRI ; Site destroye...
small image of pAcGFP1-C1pAcGFP1-C1 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: Constitutive; Promoter: CMV; Tag: GFP (Nterm); Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 632470, 632426; Comments:GFP fusion with selection for mammalian expression

Plasmids 5 - 9Descriptions
small image of pAcGFP1-N1pAcGFP1-N1 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: Constitutive; Promoter: CMV; Tag: GFP (Cterm); Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 632469, 632426; Comments:GFP fusion with selection for mammalian expression
small image of pACTpACT - Vendor:Promega; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Bacteria Resistance: Ampicillin; Mammalian Selection: G418; Catalog Number: E2440; GenBank Accession Number:AF264723; Comments:Use for CheckMate mammalian 2-hybrid system
small image of pAd_CMV_V5_DEST_Gateway_(ViraPower)pAd/CMV/V5 DEST Gateway (ViraPower) - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Viral; Stable/Transient: Transient; Promoter: CMV; Sequencing Primer: CMVPro Fwd; Sequencing Primer Sequence: 5'd[CGCAAATGGGCGGTAGGCGTG]3'; Tag: V5; Bacteria Resistance: Ampicillin; Catalog Number: V49320; Comments:Easy to clone into other vectors
small image of pAd-RFPpAd-RFP - Gene/insert name: RFP; Species of gene(s): Other; Vector backbone: pAdTrace-TO4 (Search Vector Database); 5' Sequencing primer: na (List of Sequencing Primers); Bacteria resistance: Kanamycin; High or low copy: High Copy; Grow in standard E. coli @ 37C: Yes; Selectable markers: Neomycin; If you did not originally clone this gene, from whom and where did you receive the plasmid used ...
small image of pAmCyan1-C1pAmCyan1-C1 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: Constitutive; Promoter: CMV; Tag: AmCyan (Nterm); Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 632441, 630050; Comments:AmCyan fluorescent protein fusion for mammalian expression

Plasmids 10 - 14Descriptions
small image of pAmCyan1-N1pAmCyan1-N1 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: Constitutive; Promoter: CMV; Tag: AmCyan (Cterm); Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 632442, 630050; Comments:AmCyan fluorescent protein fusion for mammalian expression
small image of pAsRed2-C1pAsRed2-C1 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: Constitutive; Promoter: CMV; Tag: AsRed2 (Nterm); Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 632450, 630050; Comments:AsRed2 fluorescent protein fusion for mammalian expression
small image of pAsRed2-N1pAsRed2-N1 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: Constitutive; Promoter: CMV; Tag: AsRed2 (Cterm); Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 632449, 630050; Comments:AsRed2 fluorescent protein fusion for mammalian expression
small image of pBABE-MN-IRES-E-GFPpBABE-MN-IRES-E-GFP - Vendor:Nolan lab; Vector Type: Mammalian; Viral/Non-viral: Retroviral; Sequencing Primer: pBMN5'; Bacteria Resistance: Ampicillin
small image of pBABE-neoVector backbone: pBABE-neo - 5' Sequencing primer: pBABE 5' ; 3' Sequencing primer: pBABE 3' ; Bacteria resistance: Ampicillin ; High or low copy: High Copy ; Grow in standard E. coli @ 37C: Yes ; Selectable markers: Neomycin ; Plasmid Provided In: DH5a ; Principal Investigator: Bob Weinberg ; Comments: Morgenstern JP, Land H., 1990, Nucleic Acids Research 18(12):3587-96.

Plasmids 15 - 19Descriptions
small image of pbgal-Basicpbgal-Basic - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: No promoter; Promoter: none; Bacteria Resistance: Ampicillin; Catalog Number: 631707; Comments:MCS upstream of b-gal reporter. Used to test cis-regulatory elements.
small image of pBIpBI - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Tet responsive; Promoter: CMV; Bacteria Resistance: Ampicillin; Catalog Number: 6152-1; Comments:Allows 2 proteins to expressed off of one vector. Used in Tet-responsive system
small image of pBI-EGFPpBI-EGFP - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Tet responsive; Promoter: CMV; Bacteria Resistance: Ampicillin; Catalog Number: 6154-1; Comments:Express your gene and GFP from same vector. Tet-responsive.
small image of pBI-GpBI-G - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Tet responsive; Promoter: CMV; Bacteria Resistance: Ampicillin; Catalog Number: 6150-1; Comments:Express your gene and b-galactosidase from same vector. Tet-responsive.
small image of pBigTpBigT - Vector Type: For making transgenic mice; Bacteria Resistance: Ampicillin; Mammalian Selection: Neomycin; Comments:Described in Srinivas et al. BMC Dev Biol (2001) vol 1, p.4. For use with pRosa26PA. See article for more information.

Plasmids 20 - 24Descriptions
small image of pBINDpBIND - Vendor:Promega; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Bacteria Resistance: Ampicillin; Catalog Number: E2440; Comments:Use for CheckMate mammalian 2-hybrid system
small image of pBlue_TOPOpBlue TOPO - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His; Bacteria Resistance: Ampicillin; Mammalian Selection: Neomycin; Catalog Number: K483101; Comments:Drives lacZ expression
small image of pBudCE4.1pBudCE4.1 - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Constitutive/Inducible: Constitutive; Promoter: CMV or EF-1a; Sequencing Primer: CMVPro Fwd, EF1aPro Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3', 5'd[TCAAGCCTCAGACAGTGGTTC]3'; Bacteria Resistance: N/a; Mammalian Selection: Zeocin; Catalog Number: V53220; Comments:Dual expression in one plasmid
small image of pCAG-Cre_GFPpCAG-Cre_GFP - Gene/insert name: Cre-GFP fusion protein; Alternative names: Cre recombinase; Species of gene(s): Bacteriophage P1; Fusion proteins or tags: GFP; Terminal: C terminal on insert; Vector backbone: pCAGEN (Search Vector Database); Cloning site 5': EcoRI; Site destroyed during cloning: No; Cloning site 3': NotI; Site destroyed during cloning: No; 5' Sequencing primer: p...
small image of pCAGIGpCAGIG - Gene/insert name: IRES-EGFP ; Alternative names: internal ribosomal entry site from Encephalomyocarditis virus green fluorescent protein from Aequorea victoria ; Vector backbone: pCAGEN; Cloning site 5': NotI ; Site destroyed during cloning: No ; Cloning site 3': MscI ; Site destroyed during cloning: Yes ; 5' Sequencing primer: pCAG-F ; Bacteria resistance: ...

Plasmids 25 - 29Descriptions
small image of pCAT3-BasicpCAT3-Basic - Vendor:Promega; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: no promoter; Expression Level: High; Sequencing Primer: T7 Fwd; Bacteria Resistance: Ampicillin; Catalog Number: E1871; GenBank Accession Number:U57024; Comments:CAT reporter; no eukaryotic promoter and enhancer sequences
small image of pCAT3-ControlpCAT3-Control - Vendor:Promega; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: SV40; Expression Level: High; Sequencing Primer: T7 Fwd; Bacteria Resistance: Ampicillin; Catalog Number: E1851; GenBank Accession Number:U57025; Comments:CAT reporter; SV40 promoter and enhancer
small image of pCAT3-EnhancerpCAT3-Enhancer - Vendor:Promega; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: no promoter; Expression Level: High; Sequencing Primer: T7 Fwd; Bacteria Resistance: Ampicillin; Catalog Number: E1881; GenBank Accession Number:U57026; Comments:CAT reporter; SV40 enhancer located downstream of CAT gene; polyA signal enables ve...
small image of pCAT3-PromoterpCAT3-Promoter - Vendor:Promega; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: SV40; Expression Level: High; Sequencing Primer: T7 Fwd; Bacteria Resistance: Ampicillin; Catalog Number: E1861; GenBank Accession Number:U57027; Comments:CAT reporter; SV40 promoter upstream of intron and CAT gene
small image of pcDNA_DEST40pcDNA DEST40 - Vendor:Invitrogen; Alternate Vector Names: pDEST40; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: V5; Bacteria Resistance: Ampicillin; Comments:Easy to clone into other vectors

Plasmids 30 - 34Descriptions
small image of pcDNA3.1(-)pcDNA3.1(-) - Vendor:Invitrogen; Alternate Vector Names: pcDNA3.1-, pcDNA3.1; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Bacteria Resistance: Ampicillin; Mammalian Selection: G418, neo; Catalog Number: V79020, V...
small image of pcDNA3.1(+)pcDNA3.1(+) - Vendor:Invitrogen; Alternate Vector Names: pcDNA3.1+, pcDNA3.1; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Bacteria Resistance: Ampicilin; Mammalian Selection: G418, neo; Catalog Number: V790-20; C...
small image of pcDNA3.1(+)_myc-His_ApcDNA3.1(+)/myc-His A - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, myc; Bacteria Resistance: Ampicillin; Mammalian Selection: G418; Catalog Number: V80020
small image of pcDNA3.1(+)_myc-His_BpcDNA3.1(+)/myc-His B - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, myc; Bacteria Resistance: Ampicillin; Mammalian Selection: G418; Catalog Number: V80020
small image of pcDNA3.1(+)_myc-His_CpcDNA3.1(+)/myc-His C - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, myc; Bacteria Resistance: Ampicillin; Mammalian Selection: G418; Catalog Number: V80020

Plasmids 35 - 39Descriptions
small image of pcDNA3.1_CT-GFP_FusionpcDNA3.1/CT-GFP Fusion - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: GFP (Cterm); Bacteria Resistance: Ampicillin; Mammalian Selection: G418
small image of pcDNA3.1_His_ApcDNA3.1/His A - Vendor:Invitrogen; Alternate Vector Names: pcDNA 3.1 His A; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His; Bacteria Resistance: Ampicillin; Mammalian Selection: neomycin; Catalog Number...
small image of pcDNA3.1_His_BpcDNA3.1/His B - Vendor:Invitrogen; Alternate Vector Names: pcDNA 3.1 His B; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His; Bacteria Resistance: Ampicillin; Mammalian Selection: neomycin; Catalog Number...
small image of pcDNA3.1_His_CpcDNA3.1/His C - Vendor:Invitrogen; Alternate Vector Names: pcDNA 3.1 His C; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: His; Bacteria Resistance: Ampicillin; Mammalian Selection: neomycin; Catalog Number...
small image of pcDNA3.1_Hygro(-)pcDNA3.1/Hygro(-) - Vendor:Invitrogen; Alternate Vector Names: pcDNA 3.1 Hygro(-); Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Bacteria Resistance: Ampicillin; Mammalian Selection: Hygromycin; Catalog Numbe...

Plasmids 40 - 44Descriptions
small image of pcDNA3.1_Hygro(+)pcDNA3.1/Hygro(+) - Vendor:Invitrogen; Alternate Vector Names: pcDNA 3.1 Hygro (+); Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Bacteria Resistance: Ampicillin; Mammalian Selection: Hygromycin; Catalog Numb...
small image of pcDNA3.1_NT-GFP_FusionpcDNA3.1/NT-GFP Fusion - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: GFP (Nterm); Bacteria Resistance: Ampicillin; Mammalian Selection: G418
small image of pcDNA3.1_nV5-DESTpcDNA3.1/nV5-DEST - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: V5; Bacteria Resistance: Ampicillin; Mammalian Selection: G418; Catalog Number: 12290010; Comments:Easy to clone into other vectors
small image of pcDNA3.1_Zeo(-)pcDNA3.1/Zeo(-) - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: constiutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Bacteria Resistance: Ampicillin; Mammalian Selection: Zeocin; Catalog Number: V86520; Comments:Differs from other pcDNA3.1 in dr...
small image of pcDNA3.1_Zeo(+)pcDNA3.1/Zeo(+) - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Bacteria Resistance: Ampicillin; Mammalian Selection: Zeocin; Catalog Number: V86020; Comments:Differs from other pcDNA3.1 in d...

Plasmids 45 - 49Descriptions
small image of pcDNA3.1D_V5-His-TOPOpcDNA3.1D V5-His-TOPO - Vendor:Invitrogen; Alternate Vector Names: pcDNA 3.1 D V5-His-TOPO; Vector Type: Mammalian Expression; Promoter: CMV; Sequencing Primer: T7; Sequencing Primer Sequence: BGH rev; Tag: C-terminal V5 and His tag; Bacteria Resistance: Ampicillin; Mammalian Selection: Neomycin; Catalog Number: K4900-01
small image of pcDNA31-His-AVector Backbone: pcDNA3.1/His A - Vendor: Invitrogen ; Alternate Vector Names: pcDNA 3.1 His A ; Vector Type: Mammalian ; Viral/Non-viral: Nonviral ; Stable/Transient: Transient ; Constitutive/Inducible: Constitutive ; Promoter: CMV ; Expression Level: High ; Sequencing Primer: T7 Fwd ; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3' ; Tag: His...
small image of pcDNA4_His_ApcDNA4/His A - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, Xpress; Bacteria Resistance: Ampicillin; Mammalian Selection: Zeocin; Catalog Number: V86220; Comments:Easy to clone int...
small image of pcDNA4_His_BpcDNA4/His B - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, Xpress; Bacteria Resistance: Ampicillin; Mammalian Selection: Zeocin; Catalog Number: V86220; Comments:Easy to clone int...
small image of pcDNA4_His_CpcDNA4/His C - Vendor:Invirtogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, Xpress; Bacteria Resistance: Ampicillin; Mammalian Selection: Zeocin; Catalog Number: V86220; Comments:Easy to clone int...

Plasmids 50 - 54Descriptions
small image of pcDNA4_His-Max_ApcDNA4/His-Max A - Vendor:Invitrogen; Alternate Vector Names: pcDNA4 HisMax; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, Xpress; Bacteria Resistance: Ampicillin; Mammalian Selection: Zeocin; Cat...
small image of pcDNA4_His-Max_BpcDNA4/His-Max B - Vendor:Invitrogen; Alternate Vector Names: pcDNA4 HisMax B; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, Xpress; Bacteria Resistance: Ampicillin; Mammalian Selection: Zeocin; C...
small image of pcDNA4_His-Max_CpcDNA4/His-Max C - Vendor:Invitrogen; Alternate Vector Names: pcDNA4 HisMax C; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, Xpress; Bacteria Resistance: Ampicillin; Mammalian Selection: Zeocin; C...
small image of pcDNA4_myc-His_ApcDNA4/myc-His A - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, myc; Bacteria Resistance: Ampicillin; Mammalian Selection: Zeocin; Catalog Number: V86320
small image of pcDNA4_myc-His_BpcDNA4/myc-His B - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, myc; Bacteria Resistance: Ampicillin; Mammalian Selection: Zeocin; Catalog Number: V86320

Plasmids 55 - 59Descriptions
small image of pcDNA4_myc-His_CpcDNA4/myc-His C - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, myc; Bacteria Resistance: Ampicillin; Mammalian Selection: Zeocin; Catalog Number: V86320
small image of pcDNA4_V5-His_ApcDNA4/V5-His A - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, V5; Bacteria Resistance: Ampicillin; Mammalian Selection: Zeocin; Catalog Number: V86120; Comments:Easy to clone i...
small image of pcDNA4_V5-His_BpcDNA4/V5-His B - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, V5; Bacteria Resistance: Ampicillin; Mammalian Selection: Zeocin; Catalog Number: V86120; Comments:Easy to clone into other vectors.
small image of pcDNA4_V5-His_CpcDNA4/V5-His C - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 'd[TAATACGACTCACTATAGGG]3'; Bacteria Resistance: Ampicillin; Mammalian Selection: Zeocin; Catalog Number: V86120; Comments:Easy to clone into other vectors.
small image of pcDNA5_FRT_TOpcDNA5/FRT/TO - Vendor:Invitrogen; Vector Type: Mammalian; Bacteria Resistance: Ampicillin

Plasmids 60 - 64Descriptions
small image of pcDNA5_FRT_TO-EpcDNA5/FRT/TO-E - Vendor:Invitrogen; Vector Type: Mammalian; Bacteria Resistance: Ampicillin
small image of pcDNA5_FRT_TO-TOPOpcDNA5/FRT/TO-TOPO - Vendor:Invitrogen; Vector Type: Mammalian; Bacteria Resistance: Ampicillin
small image of pcDNA5_FRT_V5_His_TOPOpcDNA5/FRT/V5 His TOPO - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable; Constitutive/Inducible: Constitutive; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, V5; Bacteria Resistance: Ampicillin; Catalog Number: K602001
small image of pcDNA6.2_V5-DESTpcDNA6.2/V5-DEST - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: V5; Bacteria Resistance: Ampicillin; Mammalian Selection: Blasticidin; Catalog Number: 12489027; Comments:Easy to clone ...
small image of pcDNA6.2_V5-GW_Directional_TOPOpcDNA6.2/V5-GW/Directional TOPO - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: CMVPro Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: V5; Bacteria Resistance: Ampicillin; Mammalian Selection: Blasticidin or Neomycin (dep...

Plasmids 65 - 69Descriptions
small image of pcDNA6_BioEase-DESTpcDNA6 BioEase-DEST - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: biotin; Bacteria Resistance: Ampicillin; Mammalian Selection: Blasticidin; Catalog Number: K98001; Comments:Easy to clone into other vectors
small image of pcDNA6_His_ApcDNA6/His A - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, Xpress; Bacteria Resistance: Ampicillin; Mammalian Selection: Blasticidin; Catalog Number: V22220
small image of pcDNA6_His_BpcDNA6/His B - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, Xpress; Bacteria Resistance: Ampicillin; Mammalian Selection: Blasticidin; Catalog Number: V22220; Comments:Easy to clon...
small image of pcDNA6_His_CpcDNA6/His C - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, Xpress; Bacteria Resistance: Ampicillin; Mammalian Selection: Blasticidin; Catalog Number: V22220; Comments:Easy to clon...
small image of pcDNA6_myc-His_ApcDNA6/myc-His A - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, myc; Bacteria Resistance: Ampicillin; Mammalian Selection: Blasticidin; Catalog Number: V22120; Comments:Easy to...

Plasmids 70 - 74Descriptions
small image of pcDNA6_myc-His_BpcDNA6/myc-His B - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Consitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, myc; Bacteria Resistance: Ampicillin; Mammalian Selection: Blasticidin; Catalog Number: V22120; Comments:Easy to ...
small image of pcDNA6_myc-His_CpcDNA6/myc-His C - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, myc; Bacteria Resistance: Ampicillin; Mammalian Selection: Blasticidin; Catalog Number: V22120; Comments:Easy to...
small image of pcDNA-DEST47pcDNA-DEST47 - Vendor:Invitrogen; Alternate Vector Names: pDEST47; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: GFP (Cterm); Bacteria Resistance: Ampicillin; Mammalian Selection: Neomycin; Catalog Number: 12...
small image of pcDNA-DEST53pcDNA-DEST53 - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: GFP (Nterm); Bacteria Resistance: Ampicillin; Mammalian Selection: G418; Catalog Number: 12288-015; Comments:Easy to clone into ...
small image of pCMV_myc_cytopCMV/myc/cyto - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: CMVPro Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: myc; Bacteria Resistance: Ampicillin; Mammalian Selection: Neomycin; Catalog Number: V82020; Comments:Targets protein to c...

Plasmids 75 - 79Descriptions
small image of pCMV_myc_ERpCMV/myc/ER - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: CMVPro Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: myc; Bacteria Resistance: Ampicillin; Mammalian Selection: G418; Catalog Number: V82320; Comments:Targets protein to ER
small image of pCMV_myc_mitopCMV/myc/mito - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: CMVPro Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: myc; Bacteria Resistance: Ampicillin; Mammalian Selection: G418; Catalog Number: V82220; Comments:Targets protein to mitoc...
small image of pCMV_myc_nucpCMV/myc/nuc - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: CMVPro Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: myc; Bacteria Resistance: Ampicillin; Mammalian Selection: G418; Catalog Number: V82120; Comments:Targets protein to nucleus
small image of pCMV-HApCMV-HA - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Sequencing Primer: pCMV; Sequencing Primer Sequence: 5'd[GATCCGGTACTAGAGGAACTGAAA AAC]3'; Tag: HA (Nterm); Bacteria Resistance: Ampicillin; Catalog Number: 631604; Comments:HA tag
small image of pCMV-MycpCMV-Myc - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Sequencing Primer: pCMV; Sequencing Primer Sequence: 5'd[GATCCGGTACTAGAGGAACTGAAA AAC]3'; Tag: Myc (Nterm); Bacteria Resistance: Ampicillin; Catalog Number: 631604; Comments:Myc tag

Plasmids 80 - 84Descriptions
small image of pCMV-ScriptpCMV-Script - Vendor:Stratagene; Vector Type: Bacterial & mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: CMVPro Fwd; Bacteria Resistance: Kanamycin; Mammalian Selection: G418; Catalog Number: 212220; Comments:Can be used in both mammalian and bacterial systems
small image of pCMV-TnTpCMV-TnT - Vendor:Promega; Alternate Vector Names: pCMVTNT; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: T7 or SP6; Bacteria Resistance: Ampicillin; Catalog Number: L5620; GenBank Accession Number:AF477200; Comments:In vitro & in vivo gene expression
small image of pCMV-VSV-GpCMV-VSV-G - Vector backbone: na ; 5' Sequencing primer: T7 ; Bacteria resistance: Ampicillin ; High or low copy: High Copy ; Grow in standard E. coli @ 37C: Yes ; Plasmid Provided In: DH5a ; Principal Investigator: Bob Weinberg ; Comments: VSVG envelope protein, for use with lentiviral and MuLV vectors. ; Article: Lentivirus-delivered stable gene silencing by RNAi in primary ...
small image of pCS2+pCS2+ - Vendor: RZPD ; Vector Type: Mammalian expression ; Promoter: simian CMV IE94 ; Sequencing Primer: SP6 (5'' of insert) ; Bacteria Resistance: Ampicillin ; Comments: pCS2+ contains a strong enhancer/promoter (simian CMV IE94) followed by a polylinker and the SV40 late polyadenlyation site. An SP6 promoter is present in the 5'' untranslated region of the mRNA from the sCMV promoter, all...
small image of pCX4purpCX4pur - Vector Type: Mammalian; Viral/Non-viral: Retroviral; Bacteria Resistance: Ampicillin; Mammalian Selection: Puromycin; Comments:Akagi,T. et al., Refractory nature of normal human diploid fibroblasts with respect to oncogene-mediated transformation, PNAS 100 (23), 13567-13572 (2003).

Plasmids 85 - 89Descriptions
small image of pCXneopCXneo - Vector Type: Mammalian; Viral/Non-viral: Retroviral; Bacteria Resistance: Ampicillin; Mammalian Selection: Neomycin; Comments:Akagi,T. et al., v-Crk activates the phosphoinositide 3-kinase/AKT pathway in transformation, PNAS 97 (13), 7290-7295 (2000).
small image of pDEST26pDEST26 - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Sequencing Primer: CMVPro Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His; Bacteria Resistance: Ampicillin; Mammalian Selection: G418; Catalog Number: 11809019; Comments:Easy to clone into other vectors
small image of pDEST27pDEST27 - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Sequencing Primer: CMVPro Fwd; Sequencing Primer Sequence: 5'd[CGCAAATGGGCGGTAGGCGTG]3'; Tag: GST; Bacteria Resistance: Ampicillin; Mammalian Selection: G418; Catalog Number: 11812013; Comments:Easy to clone into other vectors
small image of pDisplaypDisplay - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Bacteria Resistance: Ampicillin; Mammalian Selection: G418; Catalog Number: V66020; Comments:Targest protein to cell surface
small image of pDNR-CMVpDNR-CMV - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Sequencing Primer: T7; Bacteria Resistance: Ampicillin; Catalog Number: 639602; Comments:Donor plasmid with loxP sites flanking gene and CMV promoter. For use with cre recombinase.

Plasmids 90 - 94Descriptions
small image of pDRIVE-CAGpDRIVE-CAG - Vendor:Invivogen; Vector Type: Mammalian; Promoter: CAG; Bacteria Resistance: Zeocin
small image of pDsRed2-1pDsRed2-1 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: Constitutive; Promoter: none; Sequencing Primer: DsRed1-N; Sequencing Primer Sequence: 5'd[GTACTGGAACTGGGGGGACAG]; Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 632405; Comments:Red fluorescent protein reporter. Used to monitor transc...
small image of pDsRed2-C1pDsRed2-C1 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: Constitutive; Promoter: CMV; Sequencing Primer: DsRed1-C; Sequencing Primer Sequence: 5'd[AGCTGGACATCACCTCCCACAACG]; Tag: DsRed2 (Nterm); Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 632407; Comments:Red fluorescent protein tag
small image of pDsRed2-N1pDsRed2-N1 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: Constitutive; Promoter: CMV; Sequencing Primer: DsRed; Sequencing Primer Sequence: 5'd[GTACTGGAACTGGGGGGACAG]; Tag: DsRed2 (Cterm); Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 632406; Comments:Red fluorescent protein tag
small image of pDsRed-Express-1pDsRed-Express-1 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: No promoter; Promoter: none; Sequencing Primer: DsRed; Sequencing Primer Sequence: 5'd[GTACTGGAACTGGGGGGACAG]; Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 632413; Comments:Red fluorescent protein reporter. Used to moni...

Plasmids 95 - 99Descriptions
small image of pDsRed-Express-C1pDsRed-Express-C1 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: Constitutive; Promoter: CMV; Sequencing Primer: DsRed1-C; Sequencing Primer Sequence: 5'd[AGCTGGACATCACCTCCCACAACG]; Tag: DsRed-Express (Nterm); Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 632430; Comments:Red fluore...
small image of pDsREd-Express-DRpDsREd-Express-DR - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: No promoter; Promoter: none; Sequencing Primer: DsRed; Sequencing Primer Sequence: 5'd[GTACTGGAACTGGGGGGACAG]; Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 632423; Comments:Red fluorescent protein (shorter half-life) ...
small image of pDsRed-Express-N1pDsRed-Express-N1 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: Constitutive; Promoter: CMV; Sequencing Primer: DsRed1-N; Sequencing Primer Sequence: 5'd[GTACTGGAACTGGGGGGACAG]; Tag: DsRed-Express (Cterm); Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 632429; Comments:Red fluoresce...
small image of pECFP-1pECFP-1 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: No promoter; Promoter: none; Sequencing Primer: EGFP-N; Sequencing Primer Sequence: 5'd[CGTCGCCGTCCAGCTCGACCAG]3'; Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 6901-1; Comments:Cyan variant of GFP reporter. Used to monitor transcription ...
small image of pECFP-C1pECFP-C1 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: Constitutive; Promoter: CMV; Sequencing Primer: EGFP-C; Sequencing Primer Sequence: 5'd[CATGGTCCTGCTGGAGTTCGTG]; Tag: ECFP (Nterm); Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 6076-1; Comments:Cyan variant of GFP tag

Plasmids 100 - 104Descriptions
small image of pECFP-N1pECFP-N1 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: Constitutive; Promoter: CMV; Sequencing Primer: EGFP-N; Sequencing Primer Sequence: 5'd[CGTCGCCGTCCAGCTCGACCAG]3'; Tag: ECFP (Cterm); Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 6900-1; Comments:Cyan variant of GFP tag
small image of pEF1_His_ApEF1/His A - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: EF-1a; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, Xpress; Bacteria Resistance: Ampicillin; Mammalian Selection: G418; Catalog Number: V92220; Comments:Easy to clone into ot...
small image of pEF1_His_BpEF1/His B - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: EF-1a; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, Xpress; Bacteria Resistance: Ampicillin; Mammalian Selection: G418; Catalog Number: V92220; Comments:Easy to clone into ot...
small image of pEF1_His_CpEF1/His C - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: EF-1a; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, Xpress; Bacteria Resistance: Ampicillin; Mammalian Selection: G418; Catalog Number: V92220; Comments:Easy to clone into ot...
small image of pEF1_myc-His_ApEF1/myc-His A - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: EF-1a; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, myc; Bacteria Resistance: Ampicillin; Mammalian Selection: G418; Catalog Number: V92120; Comments:Easy to clone in...

Plasmids 105 - 109Descriptions
small image of pEF1_myc-His_BpEF1/myc-His B - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: EF-1a; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, myc; Bacteria Resistance: Ampicillin; Mammalian Selection: G418; Catalog Number: V92120; Comments:Easy to clone in...
small image of pEF1_myc-His_CpEF1/myc-His C - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: EF-1a; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, myc; Bacteria Resistance: Ampicillin; Mammalian Selection: G418; Catalog Number: V92120; Comments:Easy to clone in...
small image of pEF1_V5_His_ApEF1/V5 His A - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: EF-1a; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, V5; Bacteria Resistance: Ampicillin; Mammalian Selection: G418; Catalog Number: V92020; Comments:Easy to clone into ...
small image of pEF1_V5_His_BpEF1/V5 His B - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: EF-1a; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, V5; Bacteria Resistance: Ampicillin; Mammalian Selection: G418; Catalog Number: V92020; Comments:Easy to clone into ...
small image of pEF1_V5_His_CpEF1/V5 His C - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: EF-1a; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, V5; Bacteria Resistance: Ampicillin; Mammalian Selection: G418; Catalog Number: V92020; Comments:Easy to clone into ...

Plasmids 110 - 114Descriptions
small image of pEF4_His_ApEF4/His A - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: EF-1a; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, Xpress; Bacteria Resistance: Ampicillin; Mammalian Selection: Zeocin; Catalog Number: V94320; Comments:Easy to clone into ...
small image of pEF4_His_BpEF4/His B - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: EF-1a; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, Xpress; Bacteria Resistance: Ampicillin; Mammalian Selection: Zeocin; Catalog Number: V94320; Comments:Easy to clone into ...
small image of pEF4_His_CpEF4/His C - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: EF-1a; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, Xpress; Bacteria Resistance: Ampicillin; Mammalian Selection: Zeocin; Catalog Number: V94320; Comments:Easy to clone into ...
small image of pEF4_myc-His_ApEF4/myc-His A - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: EF-1a; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, myc; Bacteria Resistance: Ampicillin; Mammalian Selection: Zeocin; Catalog Number: V94220; Comments:Easy to clone ...
small image of pEF4_myc-His_BpEF4/myc-His B - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: EF-1a; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, myc; Bacteria Resistance: Ampicillin; Mammalian Selection: Zeocin; Catalog Number: V94220; Comments:Easy to clone ...

Plasmids 115 - 119Descriptions
small image of pEF4_myc-His_CpEF4/myc-His C - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: EF-1a; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, myc; Bacteria Resistance: Ampicillin; Mammalian Selection: Zeocin; Catalog Number: V94220; Comments:Easy to clone ...
small image of pEF4_V5_His_ApEF4/V5 His A - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: EF-1a; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, V5; Bacteria Resistance: Ampicillin; Mammalian Selection: Zeocin; Catalog Number: V94120; Comments:Easy to clone int...
small image of pEF4_V5_His_BpEF4/V5 His B - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: EF-1a; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, V5; Bacteria Resistance: Ampicillin; Mammalian Selection: Zeocin; Catalog Number: V94120; Comments:Easy to clone int...
small image of pEF4_V5_His_CpEF4/V5 His C - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: EF-1a; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, V5; Bacteria Resistance: Ampicillin; Mammalian Selection: Zeocin; Catalog Number: V94120; Comments:Easy to clone int...
small image of pEF5_FRT_V5_DEST_GatewaypEF5/FRT/V5 DEST Gateway - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable; Constitutive/Inducible: Constitutive; Promoter: EF-1a; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: V5; Bacteria Resistance: Ampicillin; Mammalian Selection: Hygromycin; Catalog Number: V6020-20

Plasmids 120 - 124Descriptions
small image of pEF5_FRT_V5_D-TOPOpEF5/FRT/V5 D-TOPO - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable; Constitutive/Inducible: Constitutive; Promoter: EF-1a; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: V5; Bacteria Resistance: Ampicillin; Mammalian Selection: Hygromycin; Catalog Number: K6035-01
small image of pEF5_FRT_V5_TOPOpEF5/FRT/V5 TOPO - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable; Constitutive/Inducible: Constitutive; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: V5; Bacteria Resistance: Ampicillin; Mammalian Selection: Hygromycin; Catalog Number: K603501
small image of pEF6_His_ApEF6/His A - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: EF-1a; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His; Bacteria Resistance: Ampicillin; Mammalian Selection: G418, zeocin, blasticidin; Catalog Number: V96120
small image of pEF6_His_BpEF6/His B - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: EF-1a; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His; Bacteria Resistance: Ampicillin; Mammalian Selection: G418, zeocin, blasticidin; Catalog Number: V96120
small image of pEF6_His_CpEF6/His C - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: EF-1a; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: +5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His; Bacteria Resistance: Ampicillin; Mammalian Selection: G418, zeocin, blasticidin; Catalog Number: V96120

Plasmids 125 - 129Descriptions
small image of pEF6_myc-His_ApEF6/myc-His A - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: EF-1a; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, myc; Bacteria Resistance: Ampicillin; Mammalian Selection: G418, zeocin, blasticidin; Catalog Number: V96220; Comm...
small image of pEF6_myc-His_BpEF6/myc-His B - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: EF-1a; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, myc; Bacteria Resistance: Ampicillin; Mammalian Selection: G418, zeocin, blasticidin; Catalog Number: V96220; Comm...
small image of pEF6_myc-His_CpEF6/myc-His C - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: EF-1a; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, myc; Bacteria Resistance: Ampicillin; Mammalian Selection: G418, zeocin, blasticidin; Catalog Number: V96220; Comm...
small image of pEF6_V5_His_TOPOpEF6/V5 His TOPO - Vendor:Invitrogen; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: EF-1a; Expression Level: High; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, V5; Bacteria Resistance: Ampicillin; Mammalian Selection: Blasticidin; Catalog Number: K961020; Comments:Easy ...
small image of pEF-GFPpEF-GFP - Gene/insert name: EF1 alpha promoter ; Alternative names: EF1A1 promoter ; Gene/insert aliases: EEF1A1, CCS3, EF1A, PTI1, CCS-3, EEF-1, EEF1A, EF-Tu, LENG7, eEF1A-1, FLJ25721, GRAF-1EF, MGC16224, MGC102687, MGC131894, HNGC:16303 Species of gene(s): H. sapiens (human); Fusion proteins or tags: EGFP ; Terminal: C terminal on backbone ; Vector backbone: pCAGEN ; Clo...

Plasmids 130 - 134Descriptions
small image of pEGFP-1pEGFP-1 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: No promoter; Promoter: none; Sequencing Primer: EGFP-N; Sequencing Primer Sequence: 5'd[CGTCGCCGTCCAGCTCGACCAG]3'; Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 6086-1; Comments:EGFP reporter. Used to monitor transcription on cis-regulato...
small image of pEGFP-C1pEGFP-C1 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: Constitutive; Promoter: CMV; Sequencing Primer: EGFP-C; Sequencing Primer Sequence: 5'd[CATGGTCCTGCTGGAGTTCGTG]; Tag: EGFP (Nterm); Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 6084-1; Comments:EGFP tag
small image of pEGFP-C3pEGFP-C3 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: Constitutive; Promoter: CMV; Sequencing Primer: EGFP-C; Sequencing Primer Sequence: 5'd[CATGGTCCTGCTGGAGTTCGTG]; Tag: EGFP (Nterm); Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 6082-1; Comments:EGFP tag
small image of pEGFP-N1pEGFP-N1 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: Constitutive; Promoter: CMV; Sequencing Primer: CMV-F, EGFP-N; Sequencing Primer Sequence: 5'd[CGTCGCCGTCCAGCTCGACCAG]3'; Tag: EGFP (Cterm); Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 6085-1; Comments:EGFP tag
small image of pEGFP-N3pEGFP-N3 - Vendor:Clontech; Vector Type: Mammalian; Viral/Non-viral: Nonviral; Stable/Transient: Stable (transfected); Constitutive/Inducible: Constitutive; Promoter: CMV; Sequencing Primer: EGFP-N; Sequencing Primer Sequence: 5'd[CGTCGCCGTCCAGCTCGACCAG]3'; Tag: EGFP (Cterm); Bacteria Resistance: Kanamycin; Mammalian Selection: Neomycin; Catalog Number: 6080-1; Comments:EGFP tag

Plasmids 135 - 139Descriptions
small image of pIRESneo3Vector Backbone: pIRESneo3 - Vendor: Clontech ; Alternate Vector Names: pIRES neo 3 ; Vector Type: mammalian expression ; Constitutive/Inducible: constitutive ; Promoter: CMV ; Tag: IRES-neo on transcript ; Bacteria Resistance: ampicillin ; Mammalian Selection: neomycin ; Catalog Number: 6988-1
small image of pMD2pMD2.G - Gene/insert name: VSV G; Species of gene(s): Other; Vector backbone: pMD2.G (Search Vector Database); 5' Sequencing primer: CMV Fwd (List of Sequencing Primers); Bacteria resistance: Ampicillin; High or low copy: High Copy; Grow in standard E. coli @ 37C: Yes; Plasmid Provided In: DH5a; Principal Investigator: Didier Trono; Comments: Envelope plasmid. Known to work with most Aebischer a...
small image of pRK7pRK7 - Vector backbone: pRK7 ; 5' Sequencing primer: SP6 ; 3' Sequencing primer: pSG5-3' ; Bacteria resistance: Ampicillin ; High or low copy: High Copy ; Grow in standard E. coli @ 37C: Yes ; Plasmid Provided In: DH5a ; Principal Investigator: John Blenis ; Comments: Vector origin unknown (not created by the Blenis lab).
small image of pST1374pST1374 - Gene/insert name: none; Fusion proteins or tags: Flag; Terminal: N terminal on backbone; Vector backbone: pST1374 (Search Vector Database); Cloning site 5': XbaI; Site destroyed during cloning: No; Cloning site 3': BamHI; Site destroyed during cloning: No; 5' Sequencing primer: T7 (List of Sequencing Primers); Bacteria resistance: Ampicillin; High or low copy: High Copy; Grow ...



Copyright 2005 BVTech, Inc. All Rights Reserved

Search plasmid maps in this site
Google
Web biovisualtech.com
More Plasmid Map Templates
  • Mammalian expression
  • Bacterial expression
  • Cre/Lox
  • Insect expression
  • Lentiviral
  • Luciferase
  • Mammalian expression
  • Other
  • Retroviral
  • RNAi
  • Worm expression
  • Yeast expression
  • Bacterial vectors
  • Mammalian
  • Recent Release from EMBL

  • Free Software Downloads
    BVTech Photo Publisher
    Help you publish your pictures over the Internet or a local network so that other people can view them in their Web browsers
    HealthWatch
    A virtual apple a day to keep the doctor away
    Download VisualSniffer 2.0
    VisualSniffer is a powerful packet capture tool and protocol analyzer
    BVTech Plasmid
    A plasmid drawing software