|
pCMV-VSV-G
Vector backbone: na
Type of vector: Mammalian expression
Backbone size (bp): 6363
5' Sequencing primer: T7
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
Plasmid Provided In: DH5a
Principal Investigator: Bob Weinberg
Comments: VSVG envelope protein, for use with lentiviral and MuLV vectors.
Article: Lentivirus-delivered stable gene silencing by RNAi in primary cells. Stewart SA et al. (RNA 2003 Apr;9(4):493-501. Pubmed)
pRK7
Vector backbone: pRK7
Type of vector: Mammalian expression
Backbone size (bp): 4708
5' Sequencing primer: SP6
3' Sequencing primer: pSG5-3'
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
Plasmid Provided In: DH5a
Principal Investigator: John Blenis
Comments: Vector origin unknown (not created by the Blenis lab).
pBABE-neo
Vector backbone: pBABE-neo
Type of vector: Mammalian expression,Retroviral
Backbone size (bp): 5330
5' Sequencing primer: pBABE 5'
3' Sequencing primer: pBABE 3'
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
Selectable markers: Neomycin
Plasmid Provided In: DH5a
Principal Investigator: Bob Weinberg
Comments: Morgenstern JP, Land H., 1990, Nucleic Acids Research 18(12):3587-96.
pCAGIG
Gene/insert name: IRES-EGFP
Alternative names: internal ribosomal entry site from Encephalomyocarditis virus
green fluorescent protein from Aequorea victoria
Insert size (bp): 1318
Vector backbone: pCAGEN
Type of vector: Mammalian expression
Backbone size (bp): 4817
Cloning site 5': NotI
Site destroyed during cloning: No
Cloning site 3': MscI
Site destroyed during cloning: Yes
5' Sequencing primer: pCAG-F
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
If you did not originally clone this gene, from whom and where did you receive the plasmid used to derive this plasmid: IRES-GFP
was from pMX-IRES-GFP (Nosaka et al., EMBO J. 18, 4754-4765 (1999)) obtained from Dr. T. Kitamura (Univ. of Tokyo).
Plasmid Provided In: DH5a
Principal Investigator: Connie Cepko
Article: Electroporation and RNA interference in the rodent retina in vivo and in vitro. Matsuda T et al. (Proc Natl Acad Sci U S
A. 2004 Jan 6. 101(1):16-22. Pubmed)
p70-S6-kinase
Gene/insert name: p70 alpha1 S6 kinase
Alternative names: p70 S6 kinase
Insert size (bp): 1800
Gene/insert aliases: Rps6kb1
Species of gene(s): R. norvegicus (rat)
Fusion proteins or tags: HA
Terminal: N terminal on insert
Vector backbone: PMT2 (Search Vectorpedia)
Type of vector: Mammalian expression
Backbone size (bp): 5100
Cloning site 5': EcoRI
Site destroyed during cloning: No
Cloning site 3': EcoRI
Site destroyed during cloning: No
5' Sequencing primer: na (List of Sequencing Primers)
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
Plasmid Provided In: DH5a
Article: Multiple independent inputs are required for activation of the p70 S6 kinase. Weng QP et
al. (Mol Cell Biol 1995 May;15(5):2333-40. Pubmed)
Friend MLV Env YFP
Gene/insert name: Envelope
Alternative names: Env, FrMLVgp3
Insert size (bp): 2800
Gene/insert aliases: env
Species of gene(s): MuLV
Fusion proteins or tags: EYFP
Terminal: Unknown
Vector backbone: pcDNA3
Type of vector: Mammalian expression
Backbone size (bp): 8800
Cloning site 5': ?
Site destroyed during cloning: Don't Know
Cloning site 3': ?
Site destroyed during cloning: Don't Know
5' Sequencing primer: T7
3' Sequencing primer: SP6
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
Selectable markers: Neomycin
Plasmid Provided In: DH5a
Comments: YFP was cloned into the NheI site of pFr-MuLV273/274 from Abraham Pinter. The entire Env
gene was then transferred into pcDNA3.
Article: Visualization of retroviral replication in living cells reveals budding into
multivesicular bodies. Sherer NM et al. (Traffic 2003 Nov;4(11):785-801. Pubmed)
Lamp1-RFP
Gene/insert name: lysosome associated membrane protein 1
Alternative names: Lamp-1
Insert size (bp): 1200
Gene/insert aliases: Lamp1, LGP120
Species of gene(s): R. norvegicus (rat)
Fusion proteins or tags: RFP
Terminal: C terminal on backbone
Vector backbone: Modified Clontech Plasmid
Type of vector: Mammalian expression
Backbone size (bp): 4700
Cloning site 5': EcoRI
Site destroyed during cloning: No
Cloning site 3': BamHI
Site destroyed during cloning: No
5' Sequencing primer: CMV Forward
Bacteria resistance: Kanamycin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
Selectable markers: Neomycin
Plasmid Provided In: DH5a
Article: Visualization of retroviral replication in living cells reveals budding into
multivesicular bodies. Sherer NM et al. (Traffic 2003 Nov;4(11):785-801. Pubmed)
pcDNA31-His-A
Vector Backbone: pcDNA3.1/His A
Vendor: Invitrogen
Alternate Vector Names: pcDNA 3.1 His A
Vector Type: Mammalian
Viral/Non-viral: Nonviral
Stable/Transient: Transient
Constitutive/Inducible: Constitutive
Promoter: CMV
Expression Level: High
Backbone Size (bp): 5514
Sequencing Primer: T7 Fwd
Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'
Tag: His
Bacteria Resistance: Ampicillin
Mammalian Selection: neomycin
Catalog Number: V38520
pIRESneo3
Vector Backbone: pIRESneo3
Vendor: Clontech
Alternate Vector Names: pIRES neo 3
Vector Type: mammalian expression
Constitutive/Inducible: constitutive
Promoter: CMV
Backbone Size (bp): 5200
Tag: IRES-neo on transcript
Bacteria Resistance: ampicillin
Mammalian Selection: neomycin
Catalog Number: 6988-1
pEF-GFP
Gene/insert name: EF1 alpha promoter
Alternative names: EF1A1 promoter
eukaryotic translation elongation factor 1 alpha 1
EF1A1
Insert size (bp): 1188
Gene/insert aliases: EEF1A1, CCS3, EF1A, PTI1, CCS-3, EEF-1, EEF1A, EF-Tu, LENG7, eEF1A-1, FLJ25721, GRAF-1EF, MGC16224, MGC102687, MGC131894, HNGC:16303
Species of gene(s): H. sapiens (human)
Fusion proteins or tags: EGFP
Terminal: C terminal on backbone
Vector backbone: pCAGEN
Type of vector: Mammalian expression
Backbone size (bp): 3086
Cloning site 5': SpeI
Site destroyed during cloning: Yes
Cloning site 3': NotI
Site destroyed during cloning: No
5' Sequencing primer: na (List of Sequencing Primers)
3' Sequencing primer: EGFP-N
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
Plasmid Provided In: DH5a
Article: Electroporation and RNA interference in the rodent retina in vivo and in vitro. Matsuda T et al. (Proc Natl Acad Sci U S A. 2004 Jan 6. 101(1):16-22. Pubmed)
|