image of the BVTech Plasmid

Other Plasmids


6xHisGFP to BlueScribe KS - | Bluescribe KS + to BlueScribe SK + | BPV-1 to Carnegie 1 | Carnegie 2 to EMBL3 SP6/T7 left arm | EMBL3 SP6/T7 right arm to LoristE6 | pACYC184 to pBK-RSV | pCMV-Sport_1 to pENTR_H1_TO | pENTR_L1-pLac-LacZalpha-R5 to pENTR_U6 | pENTR1A to pET3a | pET3b to pET3xb | pET3xc to pFastBac1 | pFLD to pGFPTA | pGL4.26[luc2_minP_Hygro] to pT7T3-18 | pT7T3-18U to V143 pLP-HA SD - Acceptor | 

All plasmid maps listed here are created using BVTech Plasmid. If you do not have BVTech Plasmid, Click here to download the latest version of BVTech Plasmid

BVTech Plasmid is DNA sequence analysis and plasmid drawing software for Windows PCs.You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your DNA sequencing data, align sequences, and much more.

Free to try, $39.98 to buy

Payments will be processed by PayPal. PayPal is the safer, easier way to pay.

Plasmids 0 - 4Descriptions
small image of 6xHisGFP6xHisGFP - Vendor: Clontech ; GenBank Accession Number: U89936 ; Type of vector: Other
small image of Bacteriophage fd strain 478Bacteriophage fd strain 478 - GenBank Accession Number: M25198; Hosts: E.coli. Related vectors: fd. (Information source: VectorDB.); Type of Vector: Other
small image of beta-actinGFPBeta-actin GFP - Alternate Vector Names: AY952326 ; Type of vector: Other
small image of BluescribeBluescribe - GenBank Accession Number: M77811 ; Type of Vector: Other
small image of BlueScribe KS -BlueScribe KS - - GenBank Accession Number: L08784

Plasmids 5 - 9Descriptions
small image of Bluescribe KS +BlueScribe KS + - GenBank Accession Number: L08785 ; Type of Vector: Othe
small image of Bluescribe M13 -Bluescribe M13 - - GenBank Accession Number: L08782; Type of Vector: Other
small image of BlueScribe M13 +BlueScribe M13 + - GenBank Accession Number: L08783; Type of Vector: Other
small image of BlueScribe SK -BlueScribe SK - - GenBank Accession Number: L08786; Type of Vector: Other
small image of BlueScribe SK +BlueScribe SK + - GenBank Accession Number: L08787; Type of Vector: Other

Plasmids 10 - 14Descriptions
small image of BPV-1BPV-1 - GenBank Accession Number: X02346 M24622 X00473; Hosts: cow. Related vectors: cow. (Information source: VectorDB.); Type of Vector: Other
small image of BSB -BSB- - Vendor: ATCC; Catalog Number: 67725; Comments: Created by Moore, July 1995, under contract with NCBI. Constructed from Bluescribe M13- by insertion of a synthetic BstXI adapter between the PstI & XbaI sites of the polylinker region. A plasmid vector containing convenient priming sites for sequence analysis and synthesis of RNA in either direction from T3 and T7 promoters. BSB+ (away from cloning sit...
small image of BSB+BSB+ - Vendor: ATCC; Catalog Number: 67724; Comments: Created by Moore, July 1995, under contract with NCBI. BSB+ (away from cloning site) and BSB- (toward cloning site) differ in their orientation of the intergenic region from bacteriophage f1. This vector contains the integenic region from bacteriophage f1 permitting synthesis of single-strand copies of the insert. A plasmid vector containing convenient p...
small image of BSII TKS -BSII TKS- - Comments: Created by Moore, July 1995, under contract with NCBI.; Hosts: E.coli. Related vectors: pBluescript II KS-. (Information source: VectorDB.); Type of Vector: Other
small image of Carnegie 1Carnegie 1 - Vendor: ATCC; Catalog Number: 37238; GenBank Accession Number: M30841; Comments: This is a plasmid vector containing a non-autonomous P element from Drosophila melanogaster. It should be used with a helper plasmid such as ppi25.1 (ATCC 37236) or ppi25.7 (ATCC 37237). Medium is 1227 LB plus ampicillin.; Hosts: E.coli K-12, Drosophila melanogaster, E.coli.; Related vectors: pUC8, Drosophila P ...

Plasmids 15 - 19Descriptions
small image of Carnegie 2Carnegie 2 - Vendor: ATCC; Catalog Number: 37239; GenBank Accession Number: M30841; Comments: Created by Moore, July 1995, under contract with NCBI. This is a plasmid vector containing a non-autonomous P element from Drosophila melanogaster. It should be used with a helper plasmid such as ppi25.1 (ATCC 37236) or ppi25.7 (ATCC 37237). Medium is 1227 LB plus ampicillin.; Hosts: E.coli K-12, Drosophila mela...
small image of Carnegie 3Carnegie 3 - Vendor: ATCC; Catalog Number: 37240; GenBank Accession Number: M30841; Comments: Created by Moore, July 1995, under contract with NCBI. This is a plasmid vector containing a non-autonomous P element from Drosophila melanogaster. It should be used with a helper plasmid such as ppi25.1 (ATCC 37236) or ppi25.7 (ATCC 37237). Medium is 1227 LB plus ampicillin.; Hosts: E.coli K-12, Drosophila mela...
small image of Carnegie 4Carnegie 4 - Vendor: ATCC; Catalog Number: 37241; GenBank Accession Number: M30841; Comments: Created by Moore, July 1995, under contract with NCBI. This is a plasmid vector containing a non-autonomous P element from Drosophila melanogaster. It should be used with a helper plasmid such as ppi25.1 (ATCC 37236) or ppi25.7 (ATCC 37237). Medium is 1227 LB plus ampicillin.; Hosts: E.coli K-12, Drosophila mela...
small image of ColE1/Colicin E1ColE1/Colicin E1 - Vendor: Sigma; Catalog Number: COLE1; GenBank Accession Number: M33100; Comments: ColE1 plasmid makes Colicin E1, which inhibits other E. coli strains. Cells with the plasmid have immunity to Colicin E1. This is the L (light) strand. The open reading frames noted by [8] are named in FEATURES by the molecular mass of their predicted products or by the names given by [8].; Hosts: E...
small image of EMBL3 SP6/T7 left armEMBL3 SP6/T7 left arm - GenBank Accession Number: U02426; Hosts: E.coli. Related vectors: EMBL3. (Information source: VectorDB.); Type of Vector: Other

Plasmids 20 - 24Descriptions
small image of EMBL3 SP6/T7 right armEMBL3 SP6/T7 right arm - GenBank Accession Number: U02427; Hosts: E.coli. Related vectors: EMBL3. (Information source: VectorDB.); Type of Vector: Other
small image of fd-tetfd-tet - Vendor: ATCC; Catalog Number: 37000; Comments: Created by Moore, July 1995, under contract with NCBI. Has been used as the starting material to construct a vector expressing immunoglobulin variable region-gene III fusion proteins which can be screened by antigen with the intact bacteriophage (phage antibodies). [3] Distributed as infected E.coli JM101 (ATCC 33876). (ATCC staff) Medium is 1273 LB plu...
small image of fKN 16fKN 16 - Vendor: ATCC; Catalog Number: 37002; Comments: Created by Moore, July 1995, under contract with NCBI. This vector contains a deletion in the phage gene III. It exhibits a higher level of biological containment than fd-tet (ATCC 37000). (ATCC staff) fd bacteriophage vector. (ATCC staff) Medium is 1592 SM buffer.; Hosts: bacteriophage fd, E.coli K802, E.coli C600, E.coli.; Related vectors: fd-tet. (Inf...
small image of HaloTag pHT2HaloTag pHT2 - Vendor: Promega; Bacteria Resistance: Ampicillin; Catalog Number: G8241; GenBank Accession Number: AY773970; Type of Vector: Other
small image of LoristE6LoristE6 - Vendor:ATCC; Catalog Number: 37532; Comments:Created by Moore, July 1995, under contract with NCBI. Accepts blunt-ended DNA. Cosmid vector for genomic library construction. Insert-end-specific probes may be generated from T7 and SP6 promoters. Restriction digests of the clone give the following sizes (kb): BamHI--5.7; HindIII--5.7. (ATCC staff) Medium is 1236 LB plus kanamycin. Hosts: E.coli 1046, ...

Plasmids 25 - 29Descriptions
small image of pACYC184pACYC184 - Vendor:ATCC; Catalog Number: 37033; GenBank Accession Number:X06403; Comments:The sequence is circular; however, the sequence begins with a unique EcoRI site. Bases 426-706, 1153-1583, and 2918 to 3735 were determined while the rest of the sequence was taken from the published sequence of pSC101, Tn9, and p15A. Restriction digests of the clone give the following sizes (kb): EcoRI--4.3; EcoRI/BamHI-...
small image of pAMP1pAMP1 - Vendor:BRL; Comments:Created by Moore, July 1995, under contract with NCBI. Hosts: E.coli. Related vectors: pSPORT1. (Information source: VectorDB.)
small image of pBG1pBG1 - Vendor:ATCC; Catalog Number: 87035; Comments:Restriction digests of the clone give the following sizes (kb): EcoRI--3.0, 2.2, 0.55; DraI/EcoRI--2.5, 2.4, 0.7; HindIII--3.5, 2.2; PstI--5.7. (ATCC staff) The his3 insert contains the following restriction sites (approximate kb from the 5' end): BamHI--0.49; ClaI--0.04; EcoRI--0.47, 1.01; HindIII--1.03; PvuI--0.04; XbaI--0.27; XhoI--0.84. [1] Growth: LB plus a...
small image of pBK-CMVpBK-CMV - Vendor:Stratagene; Comments:Hosts: E.coli XL-1-Blue MRF'. Related vectors: pBR322, pBK-RSV. (Information source: VectorDB.)
small image of pBK-RSVpBK-RSV - Vendor:Stratagene; Catalog Number: Discontinued; Comments:Hosts: E.coli XL-1-Blue MRF'. Related vectors: pBR322, pBK-CMV. (Information source: VectorDB.)

Plasmids 30 - 34Descriptions
small image of pCMV-Sport_1pCMV-Sport 1 - Vendor:Invitrogen; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Promoter: CMV; Expression Level: High; Sequencing Primer: SP6; Tag: none; Bacteria Resistance: Ampicillin; Mammalian Selection: None
small image of pDNR-1rpDNR-1r - Vendor:Clontech; Sequencing Primer: M13; Bacteria Resistance: Ampicillin; Catalog Number: 631615; Comments:Donor plasmid with loxP sites flanking gene. For use with cre-recombinase. sold as a component in the Creator pDNR Cloning kit
small image of pDW1775pDW1775 - Gene/insert name: none ; Fusion proteins or tags: AcV5; Terminal: N terminal on backbone ; Vector backbone: pDW1775 ; Cloning site 5': XbaI ; Site destroyed during cloning: No ; Cloning site 3': BamHI ; Site destroyed during cloning: No ; 5' Sequencing primer: T7 ; 3' Sequencing primer: T3 ; Bacteria resistance: Ampicillin ; High or low copy: ...
small image of pENTR_D-TOPOpENTR/D-TOPO - Vendor:Invitrogen; Vector Type: Entry vector; Bacteria Resistance: Kanamycin; Catalog Number: K2400-20; Comments:Directional TOPO cloning vector.
small image of pENTR_H1_TOpENTR/H1/TO - Vendor:Invitrogen; Vector Type: Entry vector; Promoter: Human HI/TO; Expression Level: High; Sequencing Primer: M13 forward and reverse; Bacteria Resistance: Kanamycin; Mammalian Selection: Zeocin; Catalog Number: K4920-00; Comments:Contains a hybrid promoter consisting of human H1 promoter and two tetracycline operator sequence for RNA Polymerase III-dependant, regulated expression of the sh...

Plasmids 35 - 39Descriptions
small image of pENTR_L1-pLac-LacZalpha-R5pENTR L1-pLac-LacZalpha-R5 - Vendor:Invitrogen; Sequencing Primer: M13 F and R; Bacteria Resistance: Kanamycin; Catalog Number: 1237-102
small image of pENTR_L5-pLac-Spect-L2pENTR L5-pLac-Spect-L2 - Vendor:Invitrogen; Vector Type: Entry vector; Sequencing Primer: M13 F and R; Bacteria Resistance: Kanamycin; Catalog Number: 12357-102
small image of pENTR_SD_D-TOPOpENTR/SD/D-TOPO - Vendor:Invitrogen; Vector Type: Entry Vector; Bacteria Resistance: Kanamycin; Catalog Number: K2420-20; Comments:Contains a T7 gene 10 translational enhancer and a ribosonal binding site (RBS) for optimal expression of native protein after recombination with a prokaryotic Gateway destination vector.
small image of pENTR_TEV_D-TOPOpENTR/TEV/D-TOPO - Vendor:Invitrogen; Vector Type: Entry Vector; Bacteria Resistance: Kanamycin; Catalog Number: K252520; Comments:Contains a Tobacco Etch Virus (TEV) recognition site for efficient TEV protease dependant cleavage of an N-terminal tag from your recombinat protein after recombination and expression from a Gateway desitnation vector
small image of pENTR_U6pENTR/U6 - Vendor:Invitrogen; Promoter: Human U6; Sequencing Primer Sequence: M13 forward and reverse; Bacteria Resistance: Kanamycin; Catalog Number: K4945-00; Comments:U6 promoter allows for the RNA polymerase III-dependant expression of short hairpin RNA (shRNA).

Plasmids 40 - 44Descriptions
small image of pENTR1ApENTR1A - Vendor:Invitrogen; Alternate Vector Names: pENTR 1A; Vector Type: Entry Vector; Bacteria Resistance: Kanamycin; Catalog Number: 11813-011; Comments:Gateway Entry vector, ccdB gene (if present) requires DB3.1 E. coli. Produces in-frame (rf=0) expression-ready Entry clones.
small image of pENTR2BpENTR2B - Vendor:Invitrogen; Alternate Vector Names: pENTR 2B; Vector Type: Entry Vector; Bacteria Resistance: Kanamycin; Catalog Number: 11816-014; Comments:Gateway Entry vector, ccdB gene (if present) requires DB3.1 E. coli. Produces in-frame (rf=1) expression-ready Entry clones.
small image of pENTR3CpENTR3C - Vendor:Invitrogen; Alternate Vector Names: pENTR 3C; Vector Type: Entry Vector; Bacteria Resistance: Kanamycin; Catalog Number: 11817-012; Comments:Gateway Entry vector, ccdB gene (if present) requires DB3.1 E. coli. Produces in-frame (rf=2) expression-ready Entry clones.
small image of pENTR4pENTR4 - Vendor:Invitrogen; Alternate Vector Names: pENTR 4; Vector Type: Entry Vector; Bacteria Resistance: Kanamycin; Catalog Number: 11818-010; Comments:Gateway Entry vector, ccdB gene (if present) requires DB3.1 E. coli. Same as pENTR1A except with NcoI instead of DraI in MCS.
small image of pET3apET3a - Vendor:New England Biolabs; Comments:Hosts: E.coli. Related vectors: pBR322. (Information source: VectorDB.)

Plasmids 45 - 49Descriptions
small image of pET3bpET3b - Vendor:New England Biolabs; Comments:Hosts: E.coli. Related vectors: pBR322. (Information source: VectorDB.)
small image of pET3cpET3c - Vendor:New England Biolabs; GenBank Accession Number:M73804; Comments:Hosts: E.coli. Related vectors: pBR322. (Information source: VectorDB.)
small image of pET3dpET3d - Vendor:New England Biolabs; Comments:Hosts: E.coli. Related vectors: pBR322. (Information source: VectorDB.)
small image of pET3xapET3xa - Vendor:New England Biolabs; Comments:Hosts: E.coli. Related vectors: pBR322. (Information source: VectorDB.)
small image of pET3xbpET3xb - Vendor:New England Biolabs; Comments:Hosts: E.coli. Related vectors: pBR322. (Information source: VectorDB.)

Plasmids 50 - 54Descriptions
small image of pET3xcpET3xc - Vendor:New England Biolabs; Comments:Hosts: E.coli. Related vectors: pBR322. (Information source: VectorDB.)
small image of pET5apET5a - Vendor:New England Biolabs; Comments:Hosts: E.coli. Related vectors: pBR322. (Information source: VectorDB.)
small image of pET5bpET5b - Vendor:New England Biolabs; Comments:Hosts: E.coli. Related vectors: pBR322. (Information source: VectorDB.)
small image of pET5cpET5c - Vendor:New England Biolabs; Comments:Hosts: E.coli. Related vectors: pBR322. (Information source: VectorDB.)
small image of pFastBac1pFastBac1 - Vendor:Invitrogen; Vector Type: Baculoviral; Promoter: Polyhedrin; Sequencing Primer: polyhedrin forward; Bacteria Resistance: Ampicillin; Mammalian Selection: Gentamicin; Catalog Number: 10359016; Comments:Hosts: E.coli. Related vectors: baculovirus. (Information source: VectorDB.)

Plasmids 55 - 59Descriptions
small image of pFLDpFLD - Vendor:Invitrogen; Vector Type: Pichia pastoris; Viral/Non-viral: Nonviral; Stable/Transient: Stable; Constitutive/Inducible: Inducible (methylamine); Promoter: P-FLD1; Sequencing Primer: 3'AOX1; Sequencing Primer Sequence: 5'd[GCAAATGGCATTCTGACATCC]3'; Tag: V5 (Cterm), His (Cterm); Bacteria Resistance: Ampicillin; Mammalian Selection: Zeocin; Catalog Number: V23020; Comments:Methylamine-inducible expressi...
small image of pGAPZ_ApGAPZ A - Vendor:Invitrogen; Vector Type: Pichia pastoris; Viral/Non-viral: Nonviral; Stable/Transient: Stable; Constitutive/Inducible: Constitutive; Promoter: Glyceraldehyde-3-phosphate (Pgap); Sequencing Primer: 3'AOX1; Sequencing Primer Sequence: 5'd[GCAAATGGCATTCTGACATCC]3'; Tag: Myc (Cterm), His (Cterm); Bacteria Resistance: ?; Mammalian Selection: Zeocin; Catalog Number: V20020; Comments:Expression and p...
small image of pGAPZ_BpGAPZ B - Vendor:Invitrogen; Vector Type: Pichia pastoris; Viral/Non-viral: Nonviral; Stable/Transient: Stable; Constitutive/Inducible: Constitutive; Promoter: Glyceraldehyde-3-phosphate (Pgap); Sequencing Primer: 3'AOX1; Sequencing Primer Sequence: 5'd[GCAAATGGCATTCTGACATCC]3'; Tag: Myc (Cterm), His (Cterm); Bacteria Resistance: ?; Mammalian Selection: Zeocin; Catalog Number: V20020; Comments:Expression and p...
small image of pGAPZ_CpGAPZ C - Vendor:Invitrogen; Vector Type: Pichia pastoris; Viral/Non-viral: Nonviral; Stable/Transient: Stable; Constitutive/Inducible: Constitutive; Promoter: Glyceraldehyde-3-phosphate (Pgap); Sequencing Primer: 3'AOX1; Sequencing Primer Sequence: 5'd[GCAAATGGCATTCTGACATCC]3'; Tag: Myc (Cterm), His (Cterm); Bacteria Resistance: ?; Mammalian Selection: Zeocin; Catalog Number: V20020; Comments:Expression and p...
small image of pGFPTApGFPTA - Bacteria Resistance: Ampicillin; Comments:Ito Y., Suzuki M. and Husimi Y, A T-extended vector using a green fluorescent protein as an indicator, Gene 245 (1), 59-63 (2000).

Plasmids 60 - 64Descriptions
small image of pGL4.26[luc2_minP_Hygro]pGL4.26[luc2/minP/Hygro] - Vendor:Promega; Catalog Number: E8441; GenBank Accession Number:DQ904458
small image of pHT3T7bm+pHT3T7bm+ - Vendor:Boehringer; Comments:Hosts: E.coli. Related vectors: pHT3T7, pHT3T7bm. (Information source: VectorDB.)
small image of pLI50pLI50 - 5' Sequencing primer: N/A ; Bacteria resistance: Ampicillin ; High or low copy: Don't Know ; Grow in standard E. coli @ 37C: Yes ; Selectable markers: Chloramphenicol in S. aureus at 37C ; Plasmid Provided In: DH5a ; Principal Investigator: Chia Y. Lee ; Article: Construction of single-copy integration vectors for Staphylococcus aureus. Lee CY et al. (Gene. 1991 Jul 15. 1...
small image of pMN19pMN19 - Gene/insert name: CaMV 35S enhancers ; Vector backbone: pPZP212 ; Backbone manufacturer: Hajdukiewicz et al 1994 ; Cloning site 5': ; Site destroyed during cloning: No ; Cloning site 3': See paper and map. ; Site destroyed during cloning: No ; 5' Sequencing primer: M13 reverse ; Bacteria resistance: Spectinomycin ; High or low copy: High Copy ; Grow in sta...
small image of pT7T3-18pT7T3-18 - GenBank Accession Number: L08951; Comments: These data and their annotation were supplied to GenBank by Will Gilbert under the auspices of the GenBank Currator Program. old BRL vector.; Hosts: E.coli.; Related vectors: pBR322, pUC18, PromT7, PromT3, pT7T3-19.; (Information source: VectorDB.)

Plasmids 65 - 69Descriptions
small image of pT7T3-18UpT7T3-18U - Vendor: Amersham; Hosts: E.coli NM522.; Related vectors: pUC18, bacteriophage f1, pTZ18U, pT7T3-19U.; (Information source: VectorDB.); Type of vector: Other
small image of pT7T3-19pT7T3-19 - GenBank Accession Number: L08952; Comments: These data and their annotation were supplied to GenBank by Will Gilbert under the auspices of the GenBank Currator Program. old BRL vector.; Hosts: E.coli.; Related vectors: pBR322, pUC19, PromT7, PromT3, pT7T3-18.; (Information source: VectorDB.)
small image of pT7T3-19UpT7T3-19U - Vendor: Amersham; Sequence and Map: Sequence; Hosts: E.coli NM522. Related vectors: pUC18, bacteriophage f1, pTZ19U, pT7T3-18U. (Information source: VectorDB.)
small image of V143 pLP-HA SD - AcceptorV143 pLP-HA SD - Acceptor - Relevant mutations/deletions: Splice for 5' tags ; Fusion proteins or tags: HA ; Terminal: N terminal on backbone; Vector backbone: NA ; 5' Sequencing primer: CMV-F ; Bacteria resistance: Kanamycin ; High or low copy: High Copy ; Grow in standard E. coli @ 37C: Yes ; Plasmid Provided In: DH5a ; Principal Investigator: Tony Pawson ; Commen...



Copyright 2005 BVTech, Inc. All Rights Reserved

Search plasmid maps in this site
Google
Web biovisualtech.com
More Plasmid Map Templates
  • Other
  • Bacterial expression
  • Cre/Lox
  • Insect expression
  • Lentiviral
  • Luciferase
  • Mammalian expression
  • Other
  • Retroviral
  • RNAi
  • Worm expression
  • Yeast expression
  • Bacterial vectors
  • Mammalian
  • Recent Release from EMBL

  • Free Software Downloads
    BVTech Photo Publisher
    Help you publish your pictures over the Internet or a local network so that other people can view them in their Web browsers
    HealthWatch
    A virtual apple a day to keep the doctor away
    Download VisualSniffer 2.0
    VisualSniffer is a powerful packet capture tool and protocol analyzer
    BVTech Plasmid
    A plasmid drawing software