image of the BVTech Plasmid
Search plasmid maps in this site
More Plasmid Map Templates
  • Adenoviral
  • Bacterial expression
  • Cre/Lox
  • Insect expression
  • Lentiviral
  • Luciferase
  • Mammalian expression
  • Other
  • Retroviral
  • RNAi
  • Worm expression
  • Yeast expression
  • Bacterial vectors
  • Mammalian
  • Recent Release from EMBL
  • Free Software Downloads
    BVTech Photo Publisher
    Help you publish your pictures over the Internet or a local network so that other people can view them in their Web browsers
    A virtual apple a day to keep the doctor away
    Download VisualSniffer 2.0
    VisualSniffer is a powerful packet capture tool and protocol analyzer
    BVTech Plasmid
    A plasmid drawing software
    Download Growth Chart SDK to integrate the functionality of Growth Charts from HealthWatch Pro into your business applications

    Plasmid map of PGC-1-Cre

    Download the plasmid map
    Use BVTech Plasmid to view and edit this plasmid map.

    Dowload BVTech Plasmid
    If you do not have BVTech Plasmid, download the latest version of BVTech Plasmid here.

    BVTech Plasmid is DNA sequence analysis and plasmid drawing software for Windows PCs. You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your DNA sequencing data, align sequences, and much more.

    Free to try, $39.98 to buy

    Payments will be processed by PayPal. PayPal is the safer, easier way to pay.

    View the sequence with features on line
    PGC-1 alpha promoter luciferase delta CRE
    Gene/insert name: PGC-1 alpha promoter dCRE
    Alternative names: PGC1 promoter
    PGC-1a promoter
    Insert size (bp): 2600
    Gene/insert aliases: Ppargc1a, Pgc1, PGC-1, Pgco1, PGC-1v, Ppargc1, Pgc-1alpha, A830037N07Rik
    Species of gene(s): M. musculus (mouse)
    Relevant mutations/deletions: Site-directed mutagenesis to remove the CREB binding site.
    Fusion proteins or tags: luciferase
    Terminal: C terminal on backbone
    Vector backbone: pGL3-basic (Search Vector Database)
    Backbone manufacturer: Promega
    Type of vector: Mammalian expression,Luciferase
    Backbone size (bp): 7404
    Cloning site 5'': KpnI
    Site destroyed during cloning: No
    Cloning site 3'': XhoI
    Site destroyed during cloning: No
    5'' Sequencing primer: RVprimer3 (CTAGCAAAATAGGCTGTCCC) (List of Sequencing Primers)
    3'' Sequencing primer: GLprimer2 (CTTTATGTTTTTGGCGTCTTCCA)
    Bacteria resistance: Ampicillin
    High or low copy: High Copy
    Grow in standard E. coli @ 37C: Yes
    Sequence: View sequence
    Plasmid Provided In: DH5a
    Principal Investigator: Bruce Spiegelman
    Comments: 5'' flanking sequence of mouse PGC-1 alpha gene PCR amplified between +78 and -2533 with respect to the transcriptional start site. Mutation of the CRE site between -146 and -129 from TGACGTCA to TAGATCTA.
    Article: An autoregulatory loop controls peroxisome proliferator-activated receptor gamma coactivator 1alpha expression in muscle. Handschin C et al. (Proc Natl Acad Sci U S A. 2003 Jun 10. 100(12):7111-6. Pubmed)

    image of PGC-1-Cre

    Copyright 2005 BVTech, Inc. All Rights Reserved