|
|
Download the plasmid map
Use BVTech Plasmid to view and edit this plasmid map.
Dowload BVTech Plasmid
If you do not have BVTech Plasmid, download the latest version of BVTech Plasmid here.
BVTech Plasmid is DNA sequence analysis and plasmid drawing software for Windows PCs.
You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your
DNA sequencing data, align sequences, and much more.
Free to try, $39.98 to buy
Payments will be processed by PayPal. PayPal is the safer, easier way to pay.
|
View the sequence with features on line PGC-1 alpha promoter luciferase delta CRE Gene/insert name: PGC-1 alpha promoter dCRE Alternative names: PGC1 promoter PGC-1a promoter Insert size (bp): 2600 Gene/insert aliases: Ppargc1a, Pgc1, PGC-1, Pgco1, PGC-1v, Ppargc1, Pgc-1alpha, A830037N07Rik Species of gene(s): M. musculus (mouse) Relevant mutations/deletions: Site-directed mutagenesis to remove the CREB binding site. Fusion proteins or tags: luciferase Terminal: C terminal on backbone Vector backbone: pGL3-basic (Search Vector Database) Backbone manufacturer: Promega Type of vector: Mammalian expression,Luciferase Backbone size (bp): 7404 Cloning site 5'': KpnI Site destroyed during cloning: No Cloning site 3'': XhoI Site destroyed during cloning: No 5'' Sequencing primer: RVprimer3 (CTAGCAAAATAGGCTGTCCC) (List of Sequencing Primers) 3'' Sequencing primer: GLprimer2 (CTTTATGTTTTTGGCGTCTTCCA) Bacteria resistance: Ampicillin High or low copy: High Copy Grow in standard E. coli @ 37C: Yes Sequence: View sequence Plasmid Provided In: DH5a Principal Investigator: Bruce Spiegelman Comments: 5'' flanking sequence of mouse PGC-1 alpha gene PCR amplified between +78 and -2533 with respect to the transcriptional start site. Mutation of the CRE site between -146 and -129 from TGACGTCA to TAGATCTA. Article: An autoregulatory loop controls peroxisome proliferator-activated receptor gamma coactivator 1alpha expression in muscle. Handschin C et al. (Proc Natl Acad Sci U S A. 2003 Jun 10. 100(12):7111-6. Pubmed)
|