Download the plasmid map Use BVTech Plasmid to view and edit this plasmid map. Dowload BVTech Plasmid If you do not have BVTech Plasmid, download the latest version of BVTech Plasmid here. BVTech Plasmid is DNA sequence analysis and plasmid drawing software for Windows PCs. You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your DNA sequencing data, align sequences, and much more. Free to try, $39.98 to buy Payments will be processed by PayPal. PayPal is the safer, easier way to pay.

View the sequence with features on line
PGC-1 alpha promoter luciferase delta MEF
Gene/insert name: PGC-1 alpha promoter dMEF
Alternative names: PGC1 promoter
PGC-1a promoter
Insert size (bp): 2600
Gene/insert aliases: Ppargc1a, Pgc1, PGC-1, Pgco1, PGC-1v, Ppargc1, Pgc-1alpha, A830037N07Rik
Species of gene(s): M. musculus (mouse)
Relevant mutations/deletions: Site-directed mutagenesis to remove the MEF2 binding site.
Fusion proteins or tags: luciferase
Terminal: C terminal on backbone
Vector backbone: pGL3-basic (Search Vector Database)
Backbone manufacturer: Promega
Type of vector: Mammalian expression,Luciferase
Backbone size (bp): 4818
Cloning site 5'': KpnI
Site destroyed during cloning: No
Cloning site 3'': XhoI
Site destroyed during cloning: No
5'' Sequencing primer: RVprimer3 (CTAGCAAAATAGGCTGTCCC) (List of Sequencing Primers)
3'' Sequencing primer: GLprimer2 (CTTTATGTTTTTGGCGTCTTCCA)
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
Plasmid Provided In: DH5a
Principal Investigator: Bruce Spiegelman
Comments: 5'' flanking sequence of mouse PGC-1 alpha gene PCR amplified between +78 and -2533 with respect to the transcriptional start site. Mutation of the MEF site between -1464 and -1447 from CTAAATATAA to CTCCGCGGAA.
Article: An autoregulatory loop controls peroxisome proliferator-activated receptor gamma coactivator 1alpha expression in muscle. Handschin C et al. (Proc Natl Acad Sci U S A. 2003 Jun 10. 100(12):7111-6. Pubmed)