|
Gene/insert name: Gateway ccdB reading frame cassette
Insert size (bp): 2200
Vector backbone: RCASBP-Y
Type of vector: Retroviral
Backbone size (bp): 11600
Cloning site 5': PmeI
Site destroyed during cloning: Yes
Cloning site 3': PmeI
Site destroyed during cloning: Yes
5' Sequencing primer: gagctgagctgactctgctggtgg c
3' Sequencing primer: cagatacgcgtatatctggc
Bacteria resistance: Ampicillin,Chloramphenicol
High or low copy: Low Copy
Grow in standard E. coli @ 37C: No
Please specify bacterial strain for growth and growth condition: Db3.1 cells due to presence of ccdB gene
Plasmid Provided In: DB3.1
Principal Investigator: William J. Pavan
Article: Generation of RCAS vectors useful for functional genomic analyses. Loftus SK et al. (DNA Res. 2001 Oct 31. 8(5):221-6.
Pubmed)
Download plasmid map
Copyright 2005 BVTech, Inc. All Rights Reserved
|