All plasmid maps listed here are created using BVTech Plasmid. If you do not have BVTech Plasmid, Click here to download the latest version of BVTech Plasmid BVTech Plasmid is DNA sequence analysis and plasmid drawing software for Windows PCs.You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your DNA sequencing data, align sequences, and much more. Free to try, $39.98 to buy Payments will be processed by PayPal. PayPal is the safer, easier way to pay.

Plasmids 0 - 4	Descriptions
	L4440 - Species of gene(s): Other; Fusion proteins or tags: T7p, T7p, lacZN, OriF1>>, OriF1<<; Terminal:; Bacteria resistance: Ampicillin; High or low copy: Don't Know; Grow in standard E. coli @ 37C: Yes; Plasmid Provided In: DH5a; Principal Investigator: Andrew Fire; Comments: See Fire Lab Vector Kit Documentation 1999. Fire Lab Miniprep Number pPD129.36, Ligation number L4440.
	MDH1-PGK-GFP_2.0 - Gene/insert name: None; Vector backbone: MDH1-PGK-GFP 2.0 (Search Vector Database); 5' Sequencing primer: EGFP-C (List of Sequencing Primers); 3' Sequencing primer: ggatcccaatatttgcatgtcgc; Bacteria resistance: Ampicillin; High or low copy: High Copy; Grow in standard E. coli @ 37C: Yes; Plasmid Provided In: DH5a; Principal Investigator: Chang-Zheng Chen; Article: Mi...
	pJRtac99 - Vendor: ATCC; Catalog Number: 87018; GenBank Accession Number: X69551; Comments: MCS. oligonucleotide linker. in GenBank. Restriction digests of the clone give the following sizes (kb): EcoRI--1.3; HindIII--1.3; BglII--1.3. (ATCC staff) Expression vector permitting production of heterologous peptides fused to active chloramphenicol acetyltransferase. The replicon is derived from ColE1 and does ...
	pLKO.3G - Gene/insert name: none; Vector backbone: pLKO.3G; Cloning site 5': EcoRI; Site destroyed during cloning: No; Cloning site 3': PacI; Site destroyed during cloning: No; 5' Sequencing primer: LKO.1 5'; Bacteria resistance: Ampicillin; High or low copy: High Copy; Grow in standard E. coli @ 37C: Yes; Selectable markers: eGFP; If you did not originally clone this gene, from whom and whe...
	pLVTH - Gene/insert name: None; Vector backbone: pLVTH; Bacteria resistance: Ampicillin; High or low copy: High Copy; Grow in standard E. coli @ 37C: No; Bacterial strain for growth and growth condition: Use Stbl3 or HB101 to reduce chance of recombination. Grow at 37C; Plasmid Provided In: Stbl3; Principal Investigator: Didier Trono; Comments: This vector has been replaced by the newer pLVTHM vect...

Plasmids 5 - 9	Descriptions
	pLVTHM - Gene/insert name: None; Vector backbone: pLVTH; Bacteria resistance: Ampicillin; High or low copy: High Copy; Grow in standard E. coli @ 37C: No; Bacterial strain for growth and growth condition: Use Stbl3 or HB101 to reduce chance of recombination. Grow at 37C; Plasmid Provided In: Stbl3; Principal Investigator: Didier Trono; Comments: pLVTHM allows for direct cloning of shRNAs into the ...
	pRDI292 - Vendor: Richard Iggo; Vector Type: Mammalian, RNAi; Viral/Non-viral: Lentiviral; Bacteria Resistance: Ampicillin; Mammalian Selection: Puromycin; Comments: Lentivector for siRNA expression. The siRNA cassette must be cut by BamHI/SalI from pSuper and recloned with the same enzymes in pRDI292, therefore introducing the H1 promoter. The siRNA cassette is not in LTR, therefore will not be dupli...
	psiCHECK-1 - Vendor: Promega; Vector Type: Mammalian, RNAi; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: n/a; Bacteria Resistance: Ampicillin; Catalog Number: C8011; GenBank Accession Number: AY535006
	psiCHECK-2 - Vendor: Promega; Vector Type: Mammalian, RNAi; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: n/a; Bacteria Resistance: Ampicillin; Catalog Number: C8021; GenBank Accession Number: AY535007
	pSico - Gene/insert name: none; Relevant mutations/deletions: EGFP is expressed from this plasmid as a marker, but it is not a fusion protein. Cre causes EGFP to be recombined out of the construct, activating shRNA expression.; Vector backbone: pSico (Search Vector Database); Cloning site 5': HpaI; Site destroyed during cloning: No; Cloning site 3': XhoI; Site destroyed during cloning: No; 5' Sequ...

Plasmids 10 - 14	Descriptions
	pSUPER.puro - Vendor: OligoEngine; Vector Type: Mammalian, RNAi; Bacteria Resistance: Amp; Mammalian Selection: Puro
	pU6-mir30 - Gene/insert name: human U6 promoter-mir30 cassette; Vector backbone: pCAGEN; Cloning site 5': SalI; Site destroyed during cloning: No; Cloning site 3': PstI; Site destroyed during cloning: No; 5' Sequencing primer: N/A; Bacteria resistance: Ampicillin; High or low copy: High Copy; Grow in standard E. coli @ 37C: Yes; If you did not originally clone this gene, from whom and whe...
	V44 pHIPPY blunt - Gene/insert name: none; Vector backbone: pHIPPY; Backbone manufacturer: Moon Lab; 5' Sequencing primer: H1 primer; Bacteria resistance: zeocin (50ug/mL); High or low copy: High Copy; Grow in standard E. coli @ 37C: Yes; Selectable markers: Zeocin; Plasmid Provided In: DH5a; Principal Investigator: Randall Moon; Comments: This construct is a blunt BsmB1 site version...

Copyright 2005 BVTech, Inc. All Rights Reserved