image of the BVTech Plasmid

RNAi Plasmids


L4440 to pLVTH | pLVTHM to pSico | pSUPER to V44_pHIPPY_blunt | 

All plasmid maps listed here are created using BVTech Plasmid. If you do not have BVTech Plasmid, Click here to download the latest version of BVTech Plasmid

BVTech Plasmid is DNA sequence analysis and plasmid drawing software for Windows PCs.You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your DNA sequencing data, align sequences, and much more.

Free to try, $39.98 to buy

Payments will be processed by PayPal. PayPal is the safer, easier way to pay.

Plasmids 0 - 4Descriptions
small image of L4440L4440 - Species of gene(s): Other; Fusion proteins or tags: T7p, T7p, lacZN, OriF1>>, OriF1<<; Terminal:; Bacteria resistance: Ampicillin; High or low copy: Don't Know; Grow in standard E. coli @ 37C: Yes; Plasmid Provided In: DH5a; Principal Investigator: Andrew Fire; Comments: See Fire Lab Vector Kit Documentation 1999. Fire Lab Miniprep Number pPD129.36, Ligation number L4440.
small image of MDH1-PGK-GFP_2MDH1-PGK-GFP_2.0 - Gene/insert name: None; Vector backbone: MDH1-PGK-GFP 2.0 (Search Vector Database); 5' Sequencing primer: EGFP-C (List of Sequencing Primers); 3' Sequencing primer: ggatcccaatatttgcatgtcgc; Bacteria resistance: Ampicillin; High or low copy: High Copy; Grow in standard E. coli @ 37C: Yes; Plasmid Provided In: DH5a; Principal Investigator: Chang-Zheng Chen; Article: Mi...
small image of pJRtac99pJRtac99 - Vendor: ATCC; Catalog Number: 87018; GenBank Accession Number: X69551; Comments: MCS. oligonucleotide linker. in GenBank. Restriction digests of the clone give the following sizes (kb): EcoRI--1.3; HindIII--1.3; BglII--1.3. (ATCC staff) Expression vector permitting production of heterologous peptides fused to active chloramphenicol acetyltransferase. The replicon is derived from ColE1 and does ...
small image of pLKOpLKO.3G - Gene/insert name: none; Vector backbone: pLKO.3G; Cloning site 5': EcoRI; Site destroyed during cloning: No; Cloning site 3': PacI; Site destroyed during cloning: No; 5' Sequencing primer: LKO.1 5'; Bacteria resistance: Ampicillin; High or low copy: High Copy; Grow in standard E. coli @ 37C: Yes; Selectable markers: eGFP; If you did not originally clone this gene, from whom and whe...
small image of pLVTHpLVTH - Gene/insert name: None; Vector backbone: pLVTH; Bacteria resistance: Ampicillin; High or low copy: High Copy; Grow in standard E. coli @ 37C: No; Bacterial strain for growth and growth condition: Use Stbl3 or HB101 to reduce chance of recombination. Grow at 37C; Plasmid Provided In: Stbl3; Principal Investigator: Didier Trono; Comments: This vector has been replaced by the newer pLVTHM vect...

Plasmids 5 - 9Descriptions
small image of pLVTHMpLVTHM - Gene/insert name: None; Vector backbone: pLVTH; Bacteria resistance: Ampicillin; High or low copy: High Copy; Grow in standard E. coli @ 37C: No; Bacterial strain for growth and growth condition: Use Stbl3 or HB101 to reduce chance of recombination. Grow at 37C; Plasmid Provided In: Stbl3; Principal Investigator: Didier Trono; Comments: pLVTHM allows for direct cloning of shRNAs into the ...
small image of pRDI292pRDI292 - Vendor: Richard Iggo; Vector Type: Mammalian, RNAi; Viral/Non-viral: Lentiviral; Bacteria Resistance: Ampicillin; Mammalian Selection: Puromycin; Comments: Lentivector for siRNA expression. The siRNA cassette must be cut by BamHI/SalI from pSuper and recloned with the same enzymes in pRDI292, therefore introducing the H1 promoter. The siRNA cassette is not in LTR, therefore will not be dupli...
small image of psiCHECK-1psiCHECK-1 - Vendor: Promega; Vector Type: Mammalian, RNAi; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: n/a; Bacteria Resistance: Ampicillin; Catalog Number: C8011; GenBank Accession Number: AY535006
small image of psiCHECK-2psiCHECK-2 - Vendor: Promega; Vector Type: Mammalian, RNAi; Viral/Non-viral: Nonviral; Stable/Transient: Transient; Constitutive/Inducible: Constitutive; Expression Level: High; Sequencing Primer: n/a; Bacteria Resistance: Ampicillin; Catalog Number: C8021; GenBank Accession Number: AY535007
small image of pSicopSico - Gene/insert name: none; Relevant mutations/deletions: EGFP is expressed from this plasmid as a marker, but it is not a fusion protein. Cre causes EGFP to be recombined out of the construct, activating shRNA expression.; Vector backbone: pSico (Search Vector Database); Cloning site 5': HpaI; Site destroyed during cloning: No; Cloning site 3': XhoI; Site destroyed during cloning: No; 5' Sequ...

Plasmids 10 - 14Descriptions
small image of pSUPERpSUPER.puro - Vendor: OligoEngine; Vector Type: Mammalian, RNAi; Bacteria Resistance: Amp; Mammalian Selection: Puro
small image of pU6-mir30pU6-mir30 - Gene/insert name: human U6 promoter-mir30 cassette; Vector backbone: pCAGEN; Cloning site 5': SalI; Site destroyed during cloning: No; Cloning site 3': PstI; Site destroyed during cloning: No; 5' Sequencing primer: N/A; Bacteria resistance: Ampicillin; High or low copy: High Copy; Grow in standard E. coli @ 37C: Yes; If you did not originally clone this gene, from whom and whe...
small image of V44_pHIPPY_bluntV44 pHIPPY blunt - Gene/insert name: none; Vector backbone: pHIPPY; Backbone manufacturer: Moon Lab; 5' Sequencing primer: H1 primer; Bacteria resistance: zeocin (50ug/mL); High or low copy: High Copy; Grow in standard E. coli @ 37C: Yes; Selectable markers: Zeocin; Plasmid Provided In: DH5a; Principal Investigator: Randall Moon; Comments: This construct is a blunt BsmB1 site version...



Copyright 2005 BVTech, Inc. All Rights Reserved

Search plasmid maps in this site
Google
Web biovisualtech.com
More Plasmid Map Templates
  • RNAi
  • Bacterial expression
  • Cre/Lox
  • Insect expression
  • Lentiviral
  • Luciferase
  • Mammalian expression
  • Other
  • Retroviral
  • RNAi
  • Worm expression
  • Yeast expression
  • Bacterial vectors
  • Mammalian
  • Recent Release from EMBL

  • Free Software Downloads
    BVTech Photo Publisher
    Help you publish your pictures over the Internet or a local network so that other people can view them in their Web browsers
    HealthWatch
    A virtual apple a day to keep the doctor away
    Download VisualSniffer 2.0
    VisualSniffer is a powerful packet capture tool and protocol analyzer
    BVTech Plasmid
    A plasmid drawing software