|
RCASBP-Y DV
Gene/insert name: Gateway ccdB reading frame cassette
Insert size (bp): 2200
Vector backbone: RCASBP-Y
Type of vector: Retroviral
Backbone size (bp): 11600
Cloning site 5': PmeI
Site destroyed during cloning: Yes
Cloning site 3': PmeI
Site destroyed during cloning: Yes
5' Sequencing primer: gagctgagctgactctgctggtgg c
3' Sequencing primer: cagatacgcgtatatctggc
Bacteria resistance: Ampicillin,Chloramphenicol
High or low copy: Low Copy
Grow in standard E. coli @ 37C: No
Please specify bacterial strain for growth and growth condition: Db3.1 cells due to presence of ccdB gene
Plasmid Provided In: DB3.1
Principal Investigator: William J. Pavan
Article: Generation of RCAS vectors useful for functional genomic analyses. Loftus SK et al. (DNA Res. 2001 Oct 31. 8(5):221-6.
Pubmed)
V207 pRETRO-Triple-Flag SD - Acceptor
Gene/insert name: None
Insert size (bp): Unknown
Relevant mutations/deletions: Splice for 5' Tags
Fusion proteins or tags: 3xFLAG
Terminal: N terminal on backbone
Vector backbone: NA
Type of vector: Mammalian expression,Retroviral,Cre/Lox,Acceptor vector
Backbone size (bp): 6912
5' Sequencing primer: MSCV
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
Selectable markers: Puromycin
Plasmid Provided In: DH5a
Principal Investigator: Tony Pawson
Comments: Acceptor vector for the Creator Splice system.
Article: Modification of the Creator recombination system for proteomics applications--improved expression by addition of splice sites. Colwill K et al. (BMC Biotechnol. 2006 . 6():13. Pubmed)
pCLXSN
Gene/insert name: None
Insert size (bp): Unknown
Vector backbone: pCLXSN
Backbone manufacturer: Verma Lab
Type of vector: Mammalian expression,Retroviral
Backbone size (bp): 7807
5' Sequencing primer: LXSN primer
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
Selectable markers: Neomycin
Plasmid Provided In: DH5a
Principal Investigator: Inder M Verma
Comments: A 3.1-kb fragment of LXSN, spanning from the SacI site in the 5'LTR near the U3-R junction to the AccI site just beyond
the 3'LTR, was cloned into the 4.5-kb CMV expression construct, CMX-low, at a corresponding SacI site within the CMV immediate
early enhancer-promoter.
Article: The pCL vector system: rapid production of helper-free, high-titer, recombinant retroviruses. Naviaux RK et al. (J Virol.
1996 Aug . 70(8):5701-5. Pubmed)
MDH1-PGK-GFP_2.0
Gene/insert name: None
Insert size (bp): Unknown
Vector backbone: MDH1-PGK-GFP 2.0
Type of vector: Mammalian expression,Retroviral,RNAi
Backbone size (bp): 6963
5' Sequencing primer: EGFP-C
3' Sequencing primer: ggatcccaatatttgcatgtcgc
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
Plasmid Provided In: DH5a
Principal Investigator: Chang-Zheng Chen
Article: MicroRNAs modulate hematopoietic lineage differentiation. Chen CZ et al. (Science. 2004 Jan 2. 303(5654):83-6. Pubmed)
|