BV Tech Plasmid
Plasmid drawing software

Retroviral Plasmids

  • RCASBP-Y DV
    Gene/insert name: Gateway ccdB reading frame cassette
    Insert size (bp): 2200
    Vector backbone: RCASBP-Y
    Type of vector: Retroviral
    Backbone size (bp): 11600
    Cloning site 5': PmeI
    Site destroyed during cloning: Yes
    Cloning site 3': PmeI
    Site destroyed during cloning: Yes
    5' Sequencing primer: gagctgagctgactctgctggtgg c
    3' Sequencing primer: cagatacgcgtatatctggc
    Bacteria resistance: Ampicillin,Chloramphenicol
    High or low copy: Low Copy
    Grow in standard E. coli @ 37C: No
    Please specify bacterial strain for growth and growth condition: Db3.1 cells due to presence of ccdB gene Plasmid Provided In: DB3.1
    Principal Investigator: William J. Pavan
    Article: Generation of RCAS vectors useful for functional genomic analyses. Loftus SK et al. (DNA Res. 2001 Oct 31. 8(5):221-6. Pubmed)
  • V207 pRETRO-Triple-Flag SD - Acceptor
    Gene/insert name: None
    Insert size (bp): Unknown
    Relevant mutations/deletions: Splice for 5' Tags
    Fusion proteins or tags: 3xFLAG
    Terminal: N terminal on backbone
    Vector backbone: NA
    Type of vector: Mammalian expression,Retroviral,Cre/Lox,Acceptor vector
    Backbone size (bp): 6912
    5' Sequencing primer: MSCV
    Bacteria resistance: Ampicillin
    High or low copy: High Copy
    Grow in standard E. coli @ 37C: Yes
    Selectable markers: Puromycin
    Plasmid Provided In: DH5a
    Principal Investigator: Tony Pawson
    Comments: Acceptor vector for the Creator Splice system.
    Article: Modification of the Creator recombination system for proteomics applications--improved expression by addition of splice sites. Colwill K et al. (BMC Biotechnol. 2006 . 6():13. Pubmed)
  • pCLXSN
    Gene/insert name: None
    Insert size (bp): Unknown
    Vector backbone: pCLXSN
    Backbone manufacturer: Verma Lab
    Type of vector: Mammalian expression,Retroviral
    Backbone size (bp): 7807
    5' Sequencing primer: LXSN primer
    Bacteria resistance: Ampicillin
    High or low copy: High Copy
    Grow in standard E. coli @ 37C: Yes
    Selectable markers: Neomycin
    Plasmid Provided In: DH5a
    Principal Investigator: Inder M Verma
    Comments: A 3.1-kb fragment of LXSN, spanning from the SacI site in the 5'LTR near the U3-R junction to the AccI site just beyond the 3'LTR, was cloned into the 4.5-kb CMV expression construct, CMX-low, at a corresponding SacI site within the CMV immediate early enhancer-promoter.
    Article: The pCL vector system: rapid production of helper-free, high-titer, recombinant retroviruses. Naviaux RK et al. (J Virol. 1996 Aug . 70(8):5701-5. Pubmed)
  • MDH1-PGK-GFP_2.0
    Gene/insert name: None
    Insert size (bp): Unknown
    Vector backbone: MDH1-PGK-GFP 2.0
    Type of vector: Mammalian expression,Retroviral,RNAi
    Backbone size (bp): 6963
    5' Sequencing primer: EGFP-C
    3' Sequencing primer: ggatcccaatatttgcatgtcgc
    Bacteria resistance: Ampicillin
    High or low copy: High Copy
    Grow in standard E. coli @ 37C: Yes
    Plasmid Provided In: DH5a
    Principal Investigator: Chang-Zheng Chen
    Article: MicroRNAs modulate hematopoietic lineage differentiation. Chen CZ et al. (Science. 2004 Jan 2. 303(5654):83-6. Pubmed)



  • Copyright 2005 BVTech, Inc. All Rights Reserved

    Search
    Google
    Web biovisualtech.com
    Free Software Downloads
    BVTech Photo Publisher
    Help you publish your pictures over the Internet or a local network so that other people can view them in their Web browsers
    HealthWatch
    A virtual apple a day to keep the doctor away
    Download VisualSniffer 2.0
    VisualSniffer is a powerful packet capture tool and protocol analyzer
    BVTech Plasmid
    A plasmid drawing software