image of the BVTech Plasmid

Retroviral Plasmids


MDH1-PGK-GFP_2.0 to RCASBP-Y DV | V207 pRETRO-Triple-Flag SD - Acceptor to V207 pRETRO-Triple-Flag SD - Acceptor | 

All plasmid maps listed here are created using BVTech Plasmid. If you do not have BVTech Plasmid, Click here to download the latest version of BVTech Plasmid

BVTech Plasmid is DNA sequence analysis and plasmid drawing software for Windows PCs.You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your DNA sequencing data, align sequences, and much more.

Free to try, $39.98 to buy

Payments will be processed by PayPal. PayPal is the safer, easier way to pay.

Plasmids 0 - 4Descriptions
small image of MDH1-PGK-GFP_2.0MDH1-PGK-GFP_2.0 - Gene/insert name: None ; Vector backbone: MDH1-PGK-GFP 2.0; 5' Sequencing primer: EGFP-C ; 3' Sequencing primer: ggatcccaatatttgcatgtcgc ; Bacteria resistance: Ampicillin ; High or low copy: High Copy ; Grow in standard E. coli @ 37C: Yes ; Plasmid Provided In: DH5a ; Principal Investigator: Chang-Zheng Chen ; Article: MicroRNAs modulate hematopoietic linea...
small image of pBABE-hygropBABE-hygro - Gene/insert name: none; Vector backbone: pBABE-hygro (Search Vector Database); 5' Sequencing primer: pBABE 5' (List of Sequencing Primers); 3' Sequencing primer: pBABE 3'; Bacteria resistance: Ampicillin; High or low copy: High Copy; Grow in standard E. coli @ 37C: Yes; Selectable markers: Hygromycin; Plasmid Provided In: DH5a; Principal Investigator: Bob Weinberg; Comment...
small image of pBABE-puropBABE-puro - Gene/insert name: none; Vector backbone: pBABE-puro (Search Vector Database); 5' Sequencing primer: pBABE 5' (List of Sequencing Primers); 3' Sequencing primer: pBABE 3'; Bacteria resistance: Ampicillin; High or low copy: High Copy; Grow in standard E. coli @ 37C: Yes; Selectable markers: Puromycin; Plasmid Provided In: DH5a; Principal Investigator: Bob Weinberg; Comments: M...
small image of pCLXSNpCLXSN - Gene/insert name: None ; Vector backbone: pCLXSN ; Backbone manufacturer: Verma Lab ; 5' Sequencing primer: LXSN primer; Bacteria resistance: Ampicillin ; High or low copy: High Copy ; Grow in standard E. coli @ 37C: Yes ; Selectable markers: Neomycin ; Plasmid Provided In: DH5a ; Principal Investigator: Inder M Verma ; Comments: A 3.1-kb fragment of LXSN, ...
small image of RCASBP-Y DVRCASBP-Y DV - Gene/insert name: Gateway ccdB reading frame cassette ; Vector backbone: RCASBP-Y; Cloning site 5': PmeI ; Site destroyed during cloning: Yes ; Cloning site 3': PmeI ; Site destroyed during cloning: Yes ; 5' Sequencing primer: gagctgagctgactctgctggtgg c ; 3' Sequencing primer: cagatacgcgtatatctggc ; Bacteria resistance: Ampicillin,Chloramphenicol ; High...

Plasmids 5 - 9Descriptions
small image of V207 pRETRO-Triple-Flag SD - AcceptorV207 pRETRO-Triple-Flag SD - Acceptor - Gene/insert name: None ; Relevant mutations/deletions: Splice for 5' Tags ; Fusion proteins or tags: 3xFLAG ; Terminal: N terminal on backbone ; Vector backbone: NA ; 5' Sequencing primer: MSCV ; Bacteria resistance: Ampicillin ; High or low copy: High Copy ; Grow in standard E. coli @ 37C: Yes ; Selectable markers: Pur...



Copyright 2005 BVTech, Inc. All Rights Reserved

Search plasmid maps in this site
Google
Web biovisualtech.com
More Plasmid Map Templates
  • Retroviral
  • Bacterial expression
  • Cre/Lox
  • Insect expression
  • Lentiviral
  • Luciferase
  • Mammalian expression
  • Other
  • Retroviral
  • RNAi
  • Worm expression
  • Yeast expression
  • Bacterial vectors
  • Mammalian
  • Recent Release from EMBL

  • Free Software Downloads
    BVTech Photo Publisher
    Help you publish your pictures over the Internet or a local network so that other people can view them in their Web browsers
    HealthWatch
    A virtual apple a day to keep the doctor away
    Download VisualSniffer 2.0
    VisualSniffer is a powerful packet capture tool and protocol analyzer
    BVTech Plasmid
    A plasmid drawing software