All plasmid maps listed here are created using BVTech Plasmid. If you do not have BVTech Plasmid, Click here to download the latest version of BVTech Plasmid BVTech Plasmid is DNA sequence analysis and plasmid drawing software for Windows PCs.You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your DNA sequencing data, align sequences, and much more. Free to try, $39.98 to buy Payments will be processed by PayPal. PayPal is the safer, easier way to pay.

Plasmids 0 - 4	Descriptions
	MDH1-PGK-GFP_2.0 - Gene/insert name: None ; Vector backbone: MDH1-PGK-GFP 2.0; 5' Sequencing primer: EGFP-C ; 3' Sequencing primer: ggatcccaatatttgcatgtcgc ; Bacteria resistance: Ampicillin ; High or low copy: High Copy ; Grow in standard E. coli @ 37C: Yes ; Plasmid Provided In: DH5a ; Principal Investigator: Chang-Zheng Chen ; Article: MicroRNAs modulate hematopoietic linea...
	pBABE-hygro - Gene/insert name: none; Vector backbone: pBABE-hygro (Search Vector Database); 5' Sequencing primer: pBABE 5' (List of Sequencing Primers); 3' Sequencing primer: pBABE 3'; Bacteria resistance: Ampicillin; High or low copy: High Copy; Grow in standard E. coli @ 37C: Yes; Selectable markers: Hygromycin; Plasmid Provided In: DH5a; Principal Investigator: Bob Weinberg; Comment...
	pBABE-puro - Gene/insert name: none; Vector backbone: pBABE-puro (Search Vector Database); 5' Sequencing primer: pBABE 5' (List of Sequencing Primers); 3' Sequencing primer: pBABE 3'; Bacteria resistance: Ampicillin; High or low copy: High Copy; Grow in standard E. coli @ 37C: Yes; Selectable markers: Puromycin; Plasmid Provided In: DH5a; Principal Investigator: Bob Weinberg; Comments: M...
	pCLXSN - Gene/insert name: None ; Vector backbone: pCLXSN ; Backbone manufacturer: Verma Lab ; 5' Sequencing primer: LXSN primer; Bacteria resistance: Ampicillin ; High or low copy: High Copy ; Grow in standard E. coli @ 37C: Yes ; Selectable markers: Neomycin ; Plasmid Provided In: DH5a ; Principal Investigator: Inder M Verma ; Comments: A 3.1-kb fragment of LXSN, ...
	RCASBP-Y DV - Gene/insert name: Gateway ccdB reading frame cassette ; Vector backbone: RCASBP-Y; Cloning site 5': PmeI ; Site destroyed during cloning: Yes ; Cloning site 3': PmeI ; Site destroyed during cloning: Yes ; 5' Sequencing primer: gagctgagctgactctgctggtgg c ; 3' Sequencing primer: cagatacgcgtatatctggc ; Bacteria resistance: Ampicillin,Chloramphenicol ; High...

Plasmids 5 - 9	Descriptions
	V207 pRETRO-Triple-Flag SD - Acceptor - Gene/insert name: None ; Relevant mutations/deletions: Splice for 5' Tags ; Fusion proteins or tags: 3xFLAG ; Terminal: N terminal on backbone ; Vector backbone: NA ; 5' Sequencing primer: MSCV ; Bacteria resistance: Ampicillin ; High or low copy: High Copy ; Grow in standard E. coli @ 37C: Yes ; Selectable markers: Pur...

Copyright 2005 BVTech, Inc. All Rights Reserved