image of the BVTech Plasmid
Search plasmid maps in this site
More Plasmid Map Templates
  • Adenoviral
  • Bacterial expression
  • Cre/Lox
  • Insect expression
  • Lentiviral
  • Luciferase
  • Mammalian expression
  • Other
  • Retroviral
  • RNAi
  • Worm expression
  • Yeast expression
  • Bacterial vectors
  • Mammalian
  • Recent Release from EMBL
  • Free Software Downloads
    BVTech Photo Publisher
    Help you publish your pictures over the Internet or a local network so that other people can view them in their Web browsers
    A virtual apple a day to keep the doctor away
    Download VisualSniffer 2.0
    VisualSniffer is a powerful packet capture tool and protocol analyzer
    BVTech Plasmid
    A plasmid drawing software
    Download Growth Chart SDK to integrate the functionality of Growth Charts from HealthWatch Pro into your business applications

    Plasmid map of pAG193_CORO1C

    Download the plasmid map
    Use BVTech Plasmid to view and edit this plasmid map.

    Dowload BVTech Plasmid
    If you do not have BVTech Plasmid, download the latest version of BVTech Plasmid here.

    BVTech Plasmid is DNA sequence analysis and plasmid drawing software for Windows PCs. You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your DNA sequencing data, align sequences, and much more.

    Free to try, $39.98 to buy

    Payments will be processed by PayPal. PayPal is the safer, easier way to pay.

    View the sequence with features on line
    pAG193 CORO1C 3'UTR
    Gene/insert name: CORO1C 3'UTR
    Alternative names: CORO1C
    Insert size (bp): 380
    GenBank/Entrez ID of insert: NM_014325
    Gene/insert aliases: CORO1C, HCRNN4
    Species of gene(s): H. sapiens (human)
    Vector backbone: pIS2 (Search Vector Database)
    Backbone manufacturer: pIS2 derived from pRL-SV40 (Promega)
    Type of vector: Mammalian expression,Luciferase
    Backbone size (bp): 4109
    Cloning site 5': SacI
    Site destroyed during cloning: No
    Cloning site 3': SpeI
    Site destroyed during cloning: No
    5' Sequencing primer: EBV rev primer (GTGGTTTGTCCAAACTCATC) (List of Sequencing Primers)
    Bacteria resistance: Ampicillin
    High or low copy: High Copy
    Grow in standard E. coli @ 37C: Yes
    Plasmid Provided In: DH5a
    Principal Investigator: David Bartel
    Comments: CORO1C 3'UTR in renilla luciferase reporter plasmid. Wild-type microRNA recognition sites (seed matches): 1701-1706 and 1737-1742.
    Article: The widespread impact of mammalian MicroRNAs on mRNA repression and evolution. Farh KK et al. (Science. 2005 Dec 16. 310(5755):1817-21. Pubmed)

    image of pAG193_CORO1C

    Copyright 2005 BVTech, Inc. All Rights Reserved