image of the BVTech Plasmid
Search plasmid maps in this site
More Plasmid Map Templates
  • Adenoviral
  • Bacterial expression
  • Cre/Lox
  • Insect expression
  • Lentiviral
  • Luciferase
  • Mammalian expression
  • Other
  • Retroviral
  • RNAi
  • Worm expression
  • Yeast expression
  • Bacterial vectors
  • Mammalian
  • Recent Release from EMBL
  • Free Software Downloads
    BVTech Photo Publisher
    Help you publish your pictures over the Internet or a local network so that other people can view them in their Web browsers
    A virtual apple a day to keep the doctor away
    Download VisualSniffer 2.0
    VisualSniffer is a powerful packet capture tool and protocol analyzer
    BVTech Plasmid
    A plasmid drawing software
    Download Growth Chart SDK to integrate the functionality of Growth Charts from HealthWatch Pro into your business applications

    Plasmid map of pBAD202_Directional_TOPO

    Download the plasmid map
    Use BVTech Plasmid to view and edit this plasmid map.

    Dowload BVTech Plasmid
    If you do not have BVTech Plasmid, download the latest version of BVTech Plasmid here.

    BVTech Plasmid is DNA sequence analysis and plasmid drawing software for Windows PCs. You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your DNA sequencing data, align sequences, and much more.

    Free to try, $39.98 to buy

    Payments will be processed by PayPal. PayPal is the safer, easier way to pay.

    View the sequence with features on line
    pBAD202 Directional TOPO
    Alternate Vector Names: pBAD202/D-TOPO
    Vector Type: Bacterial
    Viral/Non-viral: Nonviral
    Stable/Transient: Transient
    Constitutive/Inducible: Constitutive
    Promoter: araBAD
    Expression Level: Tightly controlled
    Backbone size: 4400
    Sequencing Primer: pBad Fwd
    Sequencing Primer Sequence: 5'd[ATGCCATAGCATTTTTATCC]3'
    Tag: 6X His, V5
    Bacteria Resistance: Kanamycin
    Mammalian Selection: N/a
    Catalog Number: K420201
    Comments:Okay to use with Top10 OneShot comp cells

    image of pBAD202_Directional_TOPO

    Copyright 2005 BVTech, Inc. All Rights Reserved