|
|
Download the plasmid map
Use BVTech Plasmid to view and edit this plasmid map.
Dowload BVTech Plasmid
If you do not have BVTech Plasmid, download the latest version of BVTech Plasmid here.
BVTech Plasmid is DNA sequence analysis and plasmid drawing software for Windows PCs.
You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your
DNA sequencing data, align sequences, and much more.
Free to try, $39.98 to buy
Payments will be processed by PayPal. PayPal is the safer, easier way to pay.
|
View the sequence with features on line pET-29 a (+) Vendor:EMD Biosciences Alternate Vector Names: pET29a Vector Type: Bacterial Viral/Non-viral: Nonviral Stable/Transient: Transient Constitutive/Inducible: Constitutive Expression Level: High Backbone size: 5371 Sequencing Primer: T7 Fwd Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3' Tag: His (Cterm), S-tag (Nterm) Bacteria Resistance: Kanamycin Catalog Number: 69871-3 Comments:Nterm thrombin cleavage site; a,b,c vary by MCS.
|