Download the plasmid map Use BVTech Plasmid to view and edit this plasmid map. Dowload BVTech Plasmid If you do not have BVTech Plasmid, download the latest version of BVTech Plasmid here. BVTech Plasmid is DNA sequence analysis and plasmid drawing software for Windows PCs. You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your DNA sequencing data, align sequences, and much more. Free to try, $39.98 to buy Payments will be processed by PayPal. PayPal is the safer, easier way to pay.

View the sequence with features on line
pET-44 b(+)
Vendor:EMD Biosciences
Vector Type: Bacterial
Viral/Non-viral: Nonviral
Stable/Transient: Transient
Constitutive/Inducible: Constitutive
Expression Level: High
Backbone size: 7300
Sequencing Primer: T7 Fwd
Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'
Tag: His (Nterm and Cterm), HSV (Nterm)
Bacteria Resistance: Ampicillin
Catalog Number: 71122-3, 71123-3, 71124-3,
Comments:Both Nterm and Cterm His tags; Nterm thrombin cleavage site; Nterm enterokinase cleavage site; a,b,c vary by MCS