image of the BVTech Plasmid
Search plasmid maps in this site
Google
Web biovisualtech.com
More Plasmid Map Templates
  • Adenoviral
  • Bacterial expression
  • Cre/Lox
  • Insect expression
  • Lentiviral
  • Luciferase
  • Mammalian expression
  • Other
  • Retroviral
  • RNAi
  • Worm expression
  • Yeast expression
  • Bacterial vectors
  • Mammalian
  • Recent Release from EMBL
  • BVTech Plasmid

    This sequnce graph is created using BVTech Plasmid, which is DNA sequence analysis and plasmid drawing software for Windows PCs.You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your DNA sequencing data, align sequences, and much more.

    Free to try, $39.98 to buy

    Payments will be processed by PayPal. PayPal is the safer, easier way to pay.

    Sequence of pET100_Directional_TOPO

  • Download the sequence and plasmid map, and then use BVTech Plasmid to view and edit the file.
  • If you do not have BVTech Plasmid, download the latest version of BVTech Plasmid here.
  • View the plasmid map on line

    Sequence of pET100 Directional TOPO : 5764 BP; 1358 A; 1518 C; 1568 G; 1320 T; 0 other;

    ............................................................
    1caaggagatggcgcccaacagtcccccggccacggggcctgccaccatacccacgccgaa60
    1gttcctctaccgcgggttgtcagggggccggtgccccggacggtggtatgggtgcggctt60
    ............................................................
    ............................................................
    61acaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggcgat120
    61tgttcgcgagtactcgggcttcaccgctcgggctagaaggggtagccactacagccgcta120
    ................................................ pBRrevBam_pri
    ............................................................
    121ataggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccggcgta180
    121tatccgcggtcgttggcgtggacaccgcggccactacggccggtgctacgcaggccgcat180
    ............................................................
    ............................................................
    181gaggatcgagatctcgatcccgcgaaattaatacgactcactataggggaattgtgagcg240
    181ctcctagctctagagctagggcgctttaattatgctgagtgatatccccttaacactcgc240
    .............................. T7_pro.......... lacO
    .......... XbaI(255)........................................
    241gataacaattcccctctagaaataattttgtttaactttaagaaggagatatacatatgc300
    241ctattgttaaggggagatctttattaaaacaaattgaaattcttcctctatatgtatacg300
    lacO................. T7_transl_en_RBS.................
    .............................. NheI(333)....................
    301ggggttctcatcatcatcatcatcatggtatggctagcatgactggtggacagcaaatgg360
    301ccccaagagtagtagtagtagtagtaccataccgatcgtactgaccacctgtcgtttacc360
    .......... 6xHis Xpress_fwd_pri T7_gene10_leader T7_leader
    .................................................. SacI(415)
    361gtcgggatctgtacgacgatgacgataaggatcatcccttcaccaagggcgagctcaacg420
    361cagccctagacatgctgctactgctattcctagtagggaagtggttcccgctcgagttgc420
    .......... Xpress_EK........................................
    ............................................................
    421atccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaat480
    421taggccgacgattgtttcgggctttccttcgactcaaccgacgacggtggcgactcgtta480
    .............................. T7_term....... T7_Terminal_pri
    ............................................................
    481aactagcataaccccttggggcctctaaacgggtcttgaggagttttttgctgaaaggag540
    481ttgatcgtattggggaaccccggagatttgcccagaactcctcaaaaaacgactttcctc540
    .................... T7_term..............................
    ............................................................
    541gaactatatccggatatcccgcaagaggcccggcagtaccggcataaccaagcctatgcc600
    541cttgatataggcctatagggcgttctccgggccgtcatggccgtattggttcggatacgg600
    T7_term..................................................
    ............................................................
    601tacagcatccagggtgacggtgccgaggatgacgatgagcgcattgttagatttcataca660
    601atgtcgtaggtcccactgccacggctcctactgctactcgcgtaacaatctaaagtatgt660
    ............................................................
    ....................................... HindIII(709).........
    661cggtgcctgactgcgttagcaatttaactgtgataaactaccgcattaaagcttatcgat720
    661gccacggactgacgcaatcgttaaattgacactatttgatggcgtaatttcgaatagcta720
    ............................................................
    ............................................................
    721gataagctgtcaaacatgagaattaattcttgaagacgaaagggcctcgtgatacgccta780
    721ctattcgacagtttgtactcttaattaagaacttctgctttcccggagcactatgcggat780
    ............................................................
    ........................................ AatII(823)..........
    781tttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcgg840
    781aaaaatatccaattacagtactattattaccaaagaatctgcagtccaccgtgaaaagcc840
    ............................................................
    ............................................................
    841ggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccg900
    841cctttacacgcgccttggggataaacaaataaaaagatttatgtaagtttatacataggc900
    .................................................. AmpR_pro
    ............................................................
    901ctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagt960
    901gagtactctgttattgggactatttacgaagttattataactttttccttctcatactca960
    AmpR_pro..................................................
    ............................................................
    961attcaacatttccgtgtcgcccttattcccttttttgcggcattttgcct tcctgttttt1020
    961taagttgtaaaggcacagcgggaataagggaaaaaacgccgtaaaacggaaggacaaaaa1020
    ................. ORF 1 Ampicillin...........................
    ............................................................
    1021gctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtg1080
    1021cgagtgggtctttgcgaccactttcattttctacgacttctagtcaacccacgtgctcac1080
    ................. ORF 1 Ampicillin...........................
    ............................................................
    1081ggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaa1140
    1081ccaatgtagcttgacctagagttgtcgccattctaggaactctcaaaagcggggcttctt1140
    ................. ORF 1 Ampicillin...........................
    ............................................................
    1141cgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtgtt1200
    1141gcaaaaggttactactcgtgaaaatttcaagacgatacaccgcgccataatagggcacaa1200
    ................. ORF 1 Ampicillin...........................
    ............................................................
    1201gacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgag1260
    1201ctgcggcccgttctcgttgagccagcggcgtatgtgataagagtcttactgaaccaactc1260
    ................. ORF 1 Ampicillin...........................
    ............................................................
    1261tactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagt1320
    1261atgagtggtcagtgtcttttcgtagaatgcctaccgtactgtcattctcttaatacgtca1320
    ................. ORF 1 Ampicillin...........................
    ............................................................
    1321gctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggagga1380
    1321cgacggtattggtactcactattgtgacgccggttgaatgaagactgttgctagcctcct1380
    ................. ORF 1 Ampicillin...........................
    ............................................................
    1381ccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgt1440
    1381ggcttcctcgattggcgaaaaaacgtgttgtaccccctagtacattgagcggaactagca1440
    ................. ORF 1 Ampicillin...........................
    .................................................. PstI(1500)
    1441tgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgca1500
    1441acccttggcctcgacttacttcggtatggtttgctgctcgcactgtggtgctacggacgt1500
    ................. ORF 1 Ampicillin...........................
    ............................................................
    1501gcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccgg1560
    1501cgttaccgttgttgcaacgcgtttgataattgaccgcttgatgaatgagatcgaagggcc1560
    ................. ORF 1 Ampicillin...........................
    ............................................................
    1561caacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcc1620
    1561gttgttaattatctgacctacctccgcctatttcaacgtcctggtgaagacgcgagccgg1620
    ................. ORF 1 Ampicillin...........................
    ............................................................
    1621cttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggt1680
    1621gaaggccgaccgaccaaataacgactatttagacctcggccactcgcacccagagcgcca1680
    ................. ORF 1 Ampicillin...........................
    ............................................................
    1681atcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacg1740
    1681tagtaacgtcgtgaccccggtctaccattcgggagggcatagcatcaatagatgtgctgc1740
    ................. ORF 1 Ampicillin...........................
    ............................................................
    1741gggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactg1800
    1741ccctcagtccgttgatacctacttgctttatctgtctagcgactctatccacggagtgac1800
    ................. ORF 1 Ampicillin...........................
    ............................................................
    1801attaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaa1860
    1801taattcgtaaccattgacagtctggttcaaatgagtatatatgaaatctaactaaatttt1860
    ORF 1 Ampicillin............................................
    ............................................................
    1861cttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaa1920
    1861gaagtaaaaattaaattttcctagatccacttctaggaaaaactattagagtactggttt1920
    ............................................................
    ............................................................
    1921atcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaagga1980
    1921tagggaattgcactcaaaagcaaggtgactcgcagtctggggcatcttttctagtttcct1980
    ................................................ pBR322_origin
    ............................................................
    1981tcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccg2040
    1981agaagaactctaggaaaaaaagacgcgcattagacgacgaacgtttgtttttttggtggc2040
    .................. pBR322_origin............................
    ............................................................
    2041ctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaact2100
    2041gatggtcgccaccaaacaaacggcctagttctcgatggttgagaaaaaggcttccattga2100
    .................. pBR322_origin............................
    ............................................................
    2101ggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccac2160
    2101ccgaagtcgtctcgcgtctatggtttatgacaggaagatcacatcggcatcaatccggtg2160
    .................. pBR322_origin............................
    ............................................................
    2161cacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtg2220
    2161gtgaagttcttgagacatcgtggcggatgtatggagcgagacgattaggacaatggtcac2220
    .................. pBR322_origin............................
    ............................................................
    2221gctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccg2280
    2221cgacgacggtcaccgctattcagcacagaatggcccaacctgagttctgctatcaatggc2280
    .................. pBR322_origin............................
    ............................................................
    2281gataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcga2340
    2281ctattccgcgtcgccagcccgacttgccccccaagcacgtgtgtcgggtcgaacctcgct2340
    .................. pBR322_origin............................
    ............................................................
    2341acgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttccc2400
    2341tgctggatgtggcttgactctatggatgtcgcactcgatactctttcgcggtgcgaaggg2400
    .................. pBR322_origin............................
    ............................................................
    2401gaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacg2460
    2401cttccctctttccgcctgtccataggccattcgccgtcccagccttgtcctctcgcgtgc2460
    .................. pBR322_origin............................
    ............................................................
    2461agggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctc2520
    2461tccctcgaaggtccccctttgcggaccatagaaatatcaggacagcccaaagcggtggag2520
    .................. pBR322_origin............................
    ............................................................
    2521tgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgcc2580
    2521actgaactcgcagctaaaaacactacgagcagtccccccgcctcggatacctttttgcgg2580
    .................. pBR322_origin............................
    ............................................................
    2581agcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttcttt2640
    2581tcgttgcgccggaaaaatgccaaggaccggaaaacgaccggaaaacgagtgtacaagaaa2640
    pBR322_origin..............................................
    ............................................................
    2641cctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgatacc2700
    2641ggacgcaataggggactaagacacctattggcataatggcggaaactcactcgactatgg2700
    ............................................................
    ............................................................
    2701gctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgc2760
    2701cgagcggcgtcggcttgctggctcgcgtcgctcagtcactcgctccttcgccttctcgcg2760
    ............................................................
    ............................................................
    2761ctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcaatggtgcactc2820
    2761gactacgccataaaagaggaatgcgtagacacgccataaagtgtggcgttaccacgtgag2820
    ............................................................
    ............................................................
    2821tcagtacaatctgctctgatgccgcatagttaagccagtatacactccgctatcgctacg2880
    2821agtcatgttagacgagactacggcgtatcaattcggtcatatgtgaggcgatagcgatgc2880
    ............................................................
    ............................................................
    2881tgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgacgggc2940
    2881actgacccagtaccgacgcggggctgtgggcggttgtgggcgactgcgcgggactgcccg2940
    ............................................................
    ............................................................
    2941ttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtg3000
    2941aacagacgagggccgtaggcgaatgtctgttcgacactggcagaggccctcgacgtacac3000
    .................................................. pGEX_3_pri
    ............................................................
    3001tcagaggttttcaccgtcatcaccgaaacgcgcgaggcagctgcggtaaagctcatcagc3060
    3001agtctccaaaagtggcagtagtggctttgcgcgctccgtcgacgccatttcgagtagtcg3060
    .................... ROP..............................
    ............................................................
    3061gtggtcgtgaagcgattcacagatgtctgcctgttcatccgcgtccagctcgttgagttt3120
    3061caccagcacttcgctaagtgtctacagacggacaagtaggcgcaggtcgagcaactcaaa3120
    .................... ROP..............................
    ............................................................
    3121ctccagaagcgttaatgtctggcttctgataaagcgggccatgttaagggcggttttttc3180
    3121gaggtcttcgcaattacagaccgaagactatttcgcccggtacaattcccgccaaaaaag3180
    .................... ROP..............................
    ............................................................
    3181ctgtttggtcactgatgcctccgtgtaagggggatttctgttcatgggggtaatgatacc3240
    3181gacaaaccagtgactacggaggcacattccccctaaagacaagtacccccattactatgg3240
    ROP..................................................
    ............................................................
    3241gatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgcccggttact3300
    3241ctactttgctctctcctacgagtgctatgcccaatgactactacttgtacgggccaatga3300
    ............................................................
    ............................................................
    3301ggaacgttgtgagggtaaacaactggcggtatggatgcggcgggaccagagaaaaatcac3360
    3301ccttgcaacactcccatttgttgaccgccatacctacgccgccctggtctctttttagtg3360
    ............................................................
    ............................................................
    3361tcagggtcaatgccagcgcttcgttaatacagatgtaggtgttccacagggtagccagca3420
    3361agtcccagttacggtcgcgaagcaattatgtctacatccacaaggtgtcccatcggtcgt3420
    ............................................................
    ............................................................
    3421gcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgcgtttccag3480
    3421cgtaggacgctacgtctaggccttgtattaccacgtcccgcgactgaaggcgcaaaggtc3480
    ............................................................
    ............................................................
    3481actttacgaaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgtttt3540
    3481tgaaatgctttgtgcctttggcttctggtaagtacaacaacgagtccagcgtctgcaaaa3540
    ............................................................
    ............................................................
    3541gcagcagcagtcgcttcacgttcgctcgcgtatcggtgattcattctgctaaccagtaag3600
    3541cgtcgtcgtcagcgaagtgcaagcgagcgcatagccactaagtaagacgattggtcattc3600
    ............................................................
    .................................................. MscI(3660)
    3601gcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcatgcgcacccgtgg3660
    3601cgttggggcggtcggatcggcccaggagttgctgtcctcgtgctagtacgcgtgggcacc3660
    ............................................................
    ............................................................
    3661ccaggacccaacgctgcccgagatgcgccgcgtgcggctgctggagatggcggacgcgat3720
    3661ggtcctgggttgcgacgggctctacgcggcgcacgccgacgacctctaccgcctgcgcta3720
    ............................................................
    ............................................................
    3721ggatatgttctgccaagggttggtttgcgcattcacagttctccgcaagaattgattggc3780
    3721cctatacaagacggttcccaaccaaacgcgtaagtgtcaagaggcgttcttaactaaccg3780
    ............................................................
    ............................................................
    3781tccaattcttggagtggtgaatccgttagcgaggtgccgccggcttccattcaggtcgag3840
    3781aggttaagaacctcaccacttaggcaatcgctccacggcggccgaaggtaagtccagctc3840
    ............................................... tet(0-612) ORF 3
    ............................................................
    3841gtggcccggctccatgcaccgcgacgcaacgcggggaggcagacaaggtatagggcggcg3900
    3841caccgggccgaggtacgtggcgctgcgttgcgcccctccgtctgttccatatcccgccgc3900
    ................. tet(0-612) ORF 3...........................
    ............................................................
    3901cctacaatccatgccaacccgttccatgtgctcgccgaggcggcataaatcgccgtgacg3960
    3901ggatgttaggtacggttgggcaaggtacacgagcggctccgccgtatttagcggcactgc3960
    ................. tet(0-612) ORF 3...........................
    ............................................................
    3961atcagcggtccaatgatcgaagttaggctggtaagagccgcgagcgatccttgaagctgt4020
    3961tagtcgccaggttactagcttcaatccgaccattctcggcgctcgctaggaacttcgaca4020
    ................. tet(0-612) ORF 3...........................
    ............................................................
    4021ccctgatggtcgtcatctacctgcctggacagcatggcctgcaacgcgggcatcccgatg4080
    4021gggactaccagcagtagatggacggacctgtcgtaccggacgttgcgcccgtagggctac4080
    ................. tet(0-612) ORF 3 ORF 3.................
    ............................................................
    4081ccgccggaagcgagaagaatcataatggggaaggccatccagcctcgcgtcgcgaacgcc4140
    4081ggcggccttcgctcttcttagtattaccccttccggtaggtcggagcgcagcgcttgcgg4140
    .............. tet(0-612) ORF 3 ORF 3........................
    .................... EagI(4163)..............................
    4141agcaagacgtagcccagcgcgtcggccgccatgccggcgataatggcctgcttctcgccg4200
    4141tcgttctgcatcgggtcgcgcagccggcggtacggccgctattaccggacgaagagcggc4200
    .............. tet(0-612) ORF 3 ORF 3........................
    ............................................................
    4201aaacgtttggtggcgggaccagtgacgaaggcttgagcgagggcgtgcaagattccgaat4260
    4201tttgcaaaccaccgccctggtcactgcttccgaactcgctcccgcacgttctaaggctta4260
    .............. tet(0-612) ORF 3 ORF 3........................
    ............................................................
    4261accgcaagcgacaggccgatcatcgtcgcgctccagcgaaagcggtcctcgccgaaaatg4320
    4261tggcgttcgctgtccggctagtagcagcgcgaggtcgctttcgccaggagcggcttttac4320
    .............. tet(0-612) ORF 3 ORF 3........................
    ............................................................
    4321acccagagcgctgccggcacctgtcctacgagttgcatgataaagaagacagtcataagt4380
    4321tgggtctcgcgacggccgtggacaggatgctcaacgtactatttcttctgtcagtattca4380
    .............. tet(0-612) ORF 3 ORF 3........................
    ............................................................
    4381gcggcgacgatagtcatgccccgcgcccaccggaaggagctgactgggttgaaggctctc4440
    4381cgccgctgctatcagtacggggcgcgggtggccttcctcgactgacccaacttccgagag4440
    .............. tet(0-612) ORF 3 ORF 3........................
    ............................................................
    4441aagggcatcggtcgagatcccggtgcctaatgagtgagctaacttacattaattgcgttg4500
    4441ttcccgtagccagctctagggccacggattactcactcgattgaatgtaattaacgcaac4500
    .................... ORF 3..............................
    ............................................................
    4501cgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggc4560
    4501gcgagtgacgggcgaaaggtcagccctttggacagcacggtcgacgtaattacttagccg4560
    .................... ORF 3 ORF 1 lacI....................
    ............................................................
    4561caacgcgcggggagaggcggtttgcgtattgggcgccagggtggtttttcttttcaccag4620
    4561gttgcgcgcccctctccgccaaacgcataacccgcggtcccaccaaaaagaaaagtggtc4620
    ................. ORF 3 ORF 1 lacI...........................
    ............................................................
    4621tgagacgggcaacagctgattgcccttcaccgcctggccctgagagagttgcagcaagcg4680
    4621actctgcccgttgtcgactaacgggaagtggcggaccgggactctctcaacgtcgttcgc4680
    ................. ORF 3 ORF 1 lacI...........................
    ........................................ HpaI(4729)..........
    4681gtccacgctggtttgccccagcaggcgaaaatcctgtttgatggtggttaacggcgggat4740
    4681caggtgcgaccaaacggggtcgtccgcttttaggacaaactaccaccaattgccgcccta4740
    ................. ORF 3 ORF 1 lacI...........................
    ............................................................
    4741ataacatgagctgtcttcggtatcgtcgtatcccactaccgagatatccgcaccaacgcg4800
    4741tattgtactcgacagaagccatagcagcatagggtgatggctctataggcgtggttgcgc4800
    .................... ORF 1 lacI..............................
    ............................................................
    4801cagcccggactcggtaatggcgcgcattgcgcccagcgccatctgatcgttggcaaccag4860
    4801gtcgggcctgagccattaccgcgcgtaacgcgggtcgcggtagactagcaaccgttggtc4860
    .................... ORF 1 lacI..............................
    ............................................................
    4861catcgcagtgggaacgatgccctcattcagcatttgcatggtttgttgaaaaccggacat4920
    4861gtagcgtcacccttgctacgggagtaagtcgtaaacgtaccaaacaacttttggcctgta4920
    .................... ORF 1 lacI..............................
    ............................................................
    4921ggcactccagtcgccttcccgttccgctatcggctgaatttgattgcgagtgagatattt4980
    4921ccgtgaggtcagcggaagggcaaggcgatagccgacttaaactaacgctcactctataaa4980
    .................... ORF 1 lacI..............................
    ........................................ ApaI(5028)..........
    4981atgccagccagccagacgcagacgcgccgagacagaacttaatgggcccgctaacagcgc5040
    4981tacggtcggtcggtctgcgtctgcgcggctctgtcttgaattacccgggcgattgtcgcg5040
    .................... ORF 1 lacI..............................
    ............................................................
    5041gatttgctggtgacccaatgcgaccagatgctccacgcccagtcgcgtaccgtcttcatg5100
    5041ctaaacgaccactgggttacgctggtctacgaggtgcgggtcagcgcatggcagaagtac5100
    .................... ORF 1 lacI..............................
    ............................................................
    5101ggagaaaataatactgttgatgggtgtctggtcagagacatcaagaaataacgccggaac5160
    5101cctcttttattatgacaactacccacagaccagtctctgtagttctttattgcggccttg5160
    .................... ORF 1 lacI..............................
    .................................................. BclI(5217)
    5161attagtgcaggcagcttccacagcaatggcatcctggtcatccagcggatagttaatgat5220
    5161taatcacgtccgtcgaaggtgtcgttaccgtaggaccagtaggtcgcctatcaattacta5220
    .................... ORF 1 lacI..............................
    ............................................................
    5221cagcccactgacgcgttgcgcgagaagattgtgcaccgccgctttacaggcttcgacgcc5280
    5221gtcgggtgactgcgcaacgcgctcttctaacacgtggcggcgaaatgtccgaagctgcgg5280
    .................... ORF 1 lacI..............................
    ............................................................
    5281gcttcgttctaccatcgacaccaccacgctggcacccagttgatcggcgcgagatttaat5340
    5281cgaagcaagatggtagctgtggtggtgcgaccgtgggtcaactagccgcgctctaaatta5340
    .................... ORF 1 lacI..............................
    ............................................................
    5341cgccgcgacaatttgcgacggcgcgtgcagggccagactggaggtggcaacgccaatcag5400
    5341gcggcgctgttaaacgctgccgcgcacgtcccggtctgacctccaccgttgcggttagtc5400
    .................... ORF 1 lacI..............................
    ............................................................
    5401caacgactgtttgcccgccagttgttgtgccacgcggttgggaatgtaattcagctccgc5460
    5401gttgctgacaaacgggcggtcaacaacacggtgcgccaacccttacattaagtcgaggcg5460
    .................... ORF 1 lacI..............................
    ............................................................
    5461catcgccgcttccactttttcccgcgttttcgcagaaacgtggctggcctggttcaccac5520
    5461gtagcggcgaaggtgaaaaagggcgcaaaagcgtctttgcaccgaccggaccaagtggtg5520
    .................... lacI..............................
    ............................................................
    5521gcgggaaacggtctgataagagacaccggcatactctgcgacatcgtataacgttactgg5580
    5521cgccctttgccagactattctctgtggccgtatgagacgctgtagcatattgcaatgacc5580
    .................... lacI..............................
    ............................................................
    5581tttcacattcaccaccctgaattgactctcttccgggcgctatcatgccataccgcgaaa5640
    5581aaagtgtaagtggtgggacttaactgagagaaggcccgcgatagtacggtatggcgcttt5640
    lacI..................................................
    ............................................................
    5641ggttttgcgccattcgatggtgtccgggatctcgacgctctcccttatgcgactcctgca5700
    5641ccaaaacgcggtaagctaccacaggccctagagctgcgagagggaatacgctgaggacgt5700
    ............................................................
    ............................................................
    5701ttaggaagcagcccagtagtaggttgaggccgttgagcaccgccgccgcaaggaatggtg5760
    5701aatccttcgtcgggtcatcatccaactccggcaactcgtggcggcggcgttccttaccac5760
    ............................................................
    ............................................................
    5761catg........................................................5764
    5761gtac........................................................5764
    ............................................................

    References



  • Copyright 2005 BVTech, Inc. All Rights Reserved