image of the BVTech Plasmid
Search plasmid maps in this site
Google
Web biovisualtech.com
More Plasmid Map Templates
  • Adenoviral
  • Bacterial expression
  • Cre/Lox
  • Insect expression
  • Lentiviral
  • Luciferase
  • Mammalian expression
  • Other
  • Retroviral
  • RNAi
  • Worm expression
  • Yeast expression
  • Bacterial vectors
  • Mammalian
  • Recent Release from EMBL
  • BVTech Plasmid

    This sequnce graph is created using BVTech Plasmid, which is DNA sequence analysis and plasmid drawing software for Windows PCs.You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your DNA sequencing data, align sequences, and much more.

    Free to try, $39.98 to buy

    Payments will be processed by PayPal. PayPal is the safer, easier way to pay.

    Sequence of pEZ-Frt-lox-DT

  • Download the sequence and plasmid map, and then use BVTech Plasmid to view and edit the file.
  • If you do not have BVTech Plasmid, download the latest version of BVTech Plasmid here.
  • View the plasmid map on line

    Sequence of pEZ-Frt-lox-DT : 6028 BP; 1445 A; 1587 C; 1542 G; 1454 T; 0 other;

    EcoRV(5),ClaI(7) NotI(20) SacII(26)........................
    1tagatatcgatggccatagcggccgcggatccataacttcgtataatgtatgctatacga60
    1atctatagctaccggtatcgccggcgcctaggtattgaagcatattacatacgatatgct60
    ........................................ loxP..........
    ............................................................
    61agttatcctttcgagggagcttcaaaagcgctctgaagttcctatactttctagagaata120
    61tcaataggaaagctccctcgaagttttcgcgagacttcaaggatatgaaagatctcttat120
    ........................................ FRT..........
    ............................................................
    121ggaacttcggaataggaacttcaagatccccctggcgaaagggggatgtgctgcaaggcg180
    121ccttgaagccttatccttgaagttctagggggaccgctttccccctacacgacgttccgc180
    .......... FRT........................................
    ............................................................
    181attaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtga240
    181taattcaacccattgcggtcccaaaagggtcagtgctgcaacattttgctgccggtcact240
    .............................. M13_pUC_f M13_f20..........
    .......... NdeI(255)........................................
    241attcgagctctcccatatggtcgagcagtgtggttttcaagaggaagcaaaaagcctctc300
    241taagctcgagagggtataccagctcgtcacaccaaaagttctccttcgtttttcggagag300
    ............................................................
    ............................................................
    301cacccaggcctggaatgtttccacccaatgtcgagcagtgtggttttgcaagaggaagca360
    301gtgggtccggaccttacaaaggtgggttacagctcgtcacaccaaaacgttctccttcgt360
    ............................................................
    ............................................................
    361aaaagcctctccacccaggcctggaatgtttccacccaatgtcgagcaaaccccgcccag420
    361ttttcggagaggtgggtccggaccttacaaaggtgggttacagctcgtttggggcgggtc420
    ............................................................
    .......... BstBI(440)........................................
    421cgtcttgtcattggcgaattcgaacacgcagatgcagtcggggcggcgcggtcccaggtc480
    421gcagaacagtaaccgcttaagcttgtgcgtctacgtcagccccgccgcgccagggtccag480
    ............................................................
    ............................................................
    481cacttcgcatattaaggtgacgcgtgtggcctcgaacaccgagcgaccctgcagccaata540
    481gtgaagcgtataattccactgcgcacaccggagcttgtggctcgctgggacgtcggttat540
    ............................................................
    ............................................................
    541tgggatcggccattgaacaagatggattgcacgcaggttctccggccgcttgggtggaga600
    541accctagccggtaacttgttctacctaacgtgcgtccaagaggccggcgaacccacctct600
    .................... NeoR/KanR..............................
    ............................................................
    601ggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttcc660
    601ccgataagccgatactgacccgtgttgtctgttagccgacgagactacggcggcacaagg660
    .................... NeoR/KanR..............................
    ............................................................
    661ggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctga720
    661ccgacagtcgcgtccccgcgggccaagaaaaacagttctggctggacaggccacgggact720
    .................... NeoR/KanR..............................
    ............................................................
    721atgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggc gttccttgcg780
    721tacttgacgtcctgctccgtcgcgccgatagcaccgaccggtgctgcccgcaaggaacgc780
    ................. NeoR/KanR ORF 1...........................
    ............................................................
    781cagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattg ggcgaagtgc840
    781gtcgacacgagctgcaacagtgacttcgcccttccctgaccgacgataacccgcttcacg840
    ................. NeoR/KanR ORF 1...........................
    ............................................................
    841cggggcaggatctcctgtgcatctcaccttgctcctgccgagaaagtatc catcatggct900
    841gccccgtcctagaggacacgtagagtggaacgaggacggctctttcataggtagtaccga900
    ................. NeoR/KanR ORF 1...........................
    ............................................................
    901gatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcga ccaccaagcg960
    901ctacgttacgccgccgacgtatgcgaactaggccgatggacgggtaagctggtggttcgc960
    ................. NeoR/KanR ORF 1...........................
    ............................................................
    961aaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcga tcaggatgat1020
    961tttgtagcgtagctcgctcgtgcatgagcctaccttcggccagaacagctagtcctacta1020
    ................. NeoR/KanR ORF 1...........................
    ............................................................
    1021ctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgc1080
    1021gacctgcttctcgtagtccccgagcgcggtcggcttgacaagcggtccgagttccgcgcg1080
    ................. NeoR/KanR ORF 1...........................
    ............................................................
    1081atgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatg1140
    1081tacgggctgccgctcctagagcagcactgggtaccgctacggacgaacggcttatagtac1140
    ................. NeoR/KanR ORF 1...........................
    ............................................................
    1141gtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgc1200
    1141caccttttaccggcgaaaagacctaagtagctgacaccggccgacccacaccgcctggcg1200
    ................. NeoR/KanR ORF 1...........................
    ............................................................
    1201tatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggct1260
    1201atagtcctgtatcgcaaccgatgggcactataacgacttctcgaaccgccgcttacccga1260
    ................. NeoR/KanR ORF 1...........................
    ............................................................
    1261gaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctat1320
    1261ctggcgaaggagcacgaaatgccatagcggcgagggctaagcgtcgcgtagcggaagata1320
    ................. NeoR/KanR ORF 1...........................
    ............................................................
    1321cgccttcttgacgagttcttctgaggggatcggcaataaaaagacagaataaaacgcacg1380
    1321gcggaagaactgctcaagaagactcccctagccgttatttttctgtcttattttgcgtgc1380
    ....... NeoR/KanR ORF 1.....................................
    ............................................................
    1381ggtgttgggtcgtttgttcggatccgtcgagggagcttcaaaagcgctctgaagttccta1440
    1381ccacaacccagcaaacaagcctaggcagctccctcgaagttttcgcgagacttcaaggat1440
    .................................................. FRT
    ............................................................
    1441tactttctagagaataggaacttcggaataggaacttcaagatccccctggcgaaagggg1500
    1441atgaaagatctcttatccttgaagccttatccttgaagttctagggggaccgctttcccc1500
    .......... FRT........................................
    SalI(1507)............................ HindIII(1547)........
    1501gatgtggtcgacataacttcgtataatgtatgctatacgaagttataagcttgcggccgg1560
    1501ctacaccagctgtattgaagcatattacatacgatatgcttcaatattcgaacgccggcc1560
    .................... loxP..............................
    XhoI(1568)..................................................
    1561ccgccacctcgagccccagctggttctttccgcctcagaagccatagagcccaccgcatc1620
    1561ggcggtggagctcggggtcgaccaagaaaggcggagtcttcggtatctcgggtggcgtag1620
    ................................................. bGH_PA_term
    ............................................................
    1621cccagcatgcctgctattgtcttcccaatcctcccccttgctgtcctgccccaccccacc1680
    1621gggtcgtacggacgataacagaagggttaggagggggaacgacaggacggggtggggtgg1680
    ................... bGH_PA_term.............................
    ............................................................
    1681ccccagaatagaatgacacctactcagacaatgcgatgcaatttcctcattttattagga1740
    1681ggggtcttatcttactgtggatgagtctgttacgctacgttaaaggagtaaaataatcct1740
    ................... bGH_PA_term.............................
    ............................................................
    1741aaggacagtgggagtggcaccttccagggtcaaggaaggcacgggggaggggcaaacaac1800
    1741ttcctgtcaccctcaccgtggaaggtcccagttccttccgtgccccctccccgtttgttg1800
    ................... bGH_PA_term.............................
    .............................. BclI(1834)....................
    1801agatggctggcaactagaaggcacagtcgaggctgatcagcgagctctaggatctgcatt1860
    1801tctaccgaccgttgatcttccgtgtcagctccgactagtcgctcgagatcctagacgtaa1860
    ......... bGH_PA_term BGH_r.............................
    ............................................................
    1861ccaccactgctcccattcatcagttccataggttggaatctaaaatacacaaacaattag1920
    1861ggtggtgacgagggtaagtagtcaaggtatccaaccttagattttatgtgtttgttaatc1920
    ...................................... SV40_3_splice........
    ............................................................
    1921aatcagtagtttaacacattatacacttaaaaattttatatttaccttagagctttaaat1980
    1921ttagtcatcaaattgtgtaatatgtgaatttttaaaatataaatggaatctcgaaattta1980
    ........ SV40_3_splice........ SV40_int.......... ORF 2
    ............................................................
    1981ctctgtaggtagtttgtccaattatgtcacaccacagaagtaaggttccttcacaaagag2040
    1981gagacatccatcaaacaggttaatacagtgtggtgtcttcattccaaggaagtgtttctc2040
    .................... ORF 2..............................
    ............................................................
    2041atcgcctgacacgatttcctgcacaggcttgagccatatactcatacatcgcatcttggc2100
    2041tagcggactgtgctaaaggacgtgtccgaactcggtatatgagtatgtagcgtagaaccg2100
    .................... ORF 2..............................
    ............................................................
    2101cacgttttccacgggtttcaaaattaatctcaagttctacgcttaacgctttcgcctgtt2160
    2101gtgcaaaaggtgcccaaagttttaattagagttcaagatgcgaattgcgaaagcggacaa2160
    .................... ORF 2..............................
    ............................................................
    2161cccagttattaatatattcaacgctagaactcccctcagcgaagggaaggctgagcacta2220
    2161gggtcaataattatataagttgcgatcttgaggggagtcgcttcccttccgactcgtgat2220
    .................... ORF 2..............................
    ............................................................
    2221cacgcgaagcaccatcaccgaaccttttgataaactcttccgttccgacttgctccatca2280
    2221gtgcgcttcgtggtagtggcttggaaaactatttgagaaggcaaggctgaacgaggtagt2280
    .................... ORF 2..............................
    ............................................................
    2281acggttcagtgagacttaaacctaactctttcttaatagtttcggcattatccactttta2340
    2281tgccaagtcactctgaatttggattgagaaagaattatcaaagccgtaataggtgaaaat2340
    .................... ORF 2..............................
    ............................................................
    2341gtgcgagaaccttcgtcagtcctggatacgtcactttgaccacgcctccagcttttccag2400
    2341cacgctcttggaagcagtcaggacctatgcagtgaaactggtgcggaggtcgaaaaggtc2400
    .................... ORF 2..............................
    ............................................................
    2401agagcgggttttcattatctacagagtatcccgcagcgtcgtatttattgtcggtactat2460
    2401tctcgcccaaaagtaatagatgtctcatagggcgtcgcagcataaataacagccatgata2460
    .................... ORF 2..............................
    ............................................................
    2461aaaaccctttccaatcatcgtcataatttccttgtgtaccagattttggcttttgtatac2520
    2461ttttgggaaaggttagtagcagtattaaaggaacacatggtctaaaaccgaaaacatatg2520
    .................... ORF 2..............................
    ............................................................
    2521ctttttgaatggaatctacataaccaggtttagtcccgtggtacgaagaaaagttttcca2580
    2521gaaaaacttaccttagatgtattggtccaaatcagggcaccatgcttcttttcaaaaggt2580
    .................... ORF 2..............................
    ............................................................
    2581tcacaaaagatttagaagaatcaacaacatcatcaggatccatggcgaggacctgcaggt2640
    2581agtgttttctaaatcttcttagttgttgtagtagtcctaggtaccgctcctggacgtcca2640
    .................... ORF 2..............................
    ............................................................
    2641cgaaaggcccggagatgaggaagaggagaacagcgcggcagacgtgcgcttttgaagcgt2700
    2641gctttccgggcctctactccttctcctcttgtcgcgccgtctgcacgcgaaaacttcgca2700
    .................... ORF 2.................... mPGK_F
    ............................................................
    2701gcagaatgccgggcctccggaggaccttcgggcgcccgccccgcccctgagcccgcccct2760
    2701cgtcttacggcccggaggcctcctggaagcccgcgggcggggcggggactcgggcgggga2760
    .................... ORF 2..............................
    ............................................................
    2761gagcccgcccccggacccaccccttcccagcctctgagcccagaaagcgaaggagcaaag2820
    2761ctcgggcgggggcctgggtggggaagggtcggagactcgggtctttcgcttcctcgtttc2820
    .................... ORF 2..............................
    ............................................................
    2821ctgctattggccgctgccccaaaggcctacccgcttccattgctcagcggtgctgtccat2880
    2821gacgataaccggcgacggggtttccggatgggcgaaggtaacgagtcgccacgacaggta2880
    .......... ORF 2........................................
    SpeI(2890)..................................................
    2881ctgcacgagactagtgagacgtgctacttccatttgtcacgtcctgcacgacgcgagctg2940
    2881gacgtgctctgatcactctgcacgatgaaggtaaacagtgcaggacgtgctgcgctcgac2940
    ............................................................
    ............................................................
    2941cggggcgggggggaacttcctgactaggggaggagtagaaggtggcgcgaaggggccacc3000
    2941gccccgcccccccttgaaggactgatcccctcctcatcttccaccgcgcttccccggtgg3000
    ............................................................
    .................... AgeI(3025)..............................
    3001aaagaacggagccggttggcgcctaccggtggatgtggaatgtgtgcgaggccagaggcc3060
    3001tttcttgcctcggccaaccgcggatggccacctacaccttacacacgctccggtctccgg3060
    ............................................................
    ............................................................
    3061acttgtgtagcgccaagtgcccagcggggctgctaaagcgcatgctccagactgccttgg3120
    3061tgaacacatcgcggttcacgggtcgccccgacgatttcgcgtacgaggtctgacggaacc3120
    .............................. MSCV_r....................
    ............................................................
    3121gaaaagcgcctcccctacccggtagaattcgatgtggagctccaattcgccctatagtga3180
    3121cttttcgcggaggggatgggccatcttaagctacacctcgaggttaagcgggatatcact3180
    .................................................. T7
    ............................................................
    3181gtcgtattacgcgcgctcactggccgtcgttttacaacgtcgtgactgggaaaaccctgg3240
    3181cagcataatgcgcgcgagtgaccggcagcaaaatgttgcagcactgacccttttgggacc3240
    T7.......... M13_f20 M13_pUC_f lacZ_a..........
    ............................................................
    3241cgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcga3300
    3241gcaatgggttgaattagcggaacgtcgtgtagggggaaagcggtcgaccgcattatcgct3300
    .................... lacZ_a..............................
    ............................................................
    3301agaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatgggacgc3360
    3301tctccgggcgtggctagcgggaagggttgtcaacgcgtcggacttaccgcttaccctgcg3360
    .................... lacZ_a..............................
    ............................................................
    3361gccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctac3420
    3361cgggacatcgccgcgtaattcgcgccgcccacaccaccaatgcgcgtcgcactggcgatg3420
    .............................. f1_origin....................
    ............................................................
    3421acttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgtt3480
    3421tgaacggtcgcgggatcgcgggcgaggaaagcgaaagaagggaaggaaagagcggtgcaa3480
    .................... f1_origin..............................
    ............................................................
    3481cgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgc3540
    3481gcggccgaaaggggcagttcgagatttagcccccgagggaaatcccaaggctaaatcacg3540
    .................... f1_origin..............................
    ............................................................
    3541tttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatc3600
    3541aaatgccgtggagctggggttttttgaactaatcccactaccaagtgcatcacccggtag3600
    .................... f1_origin..............................
    ............................................................
    3601gccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggact3660
    3601cgggactatctgccaaaaagcgggaaactgcaacctcaggtgcaagaaattatcacctga3660
    .................... f1_origin..............................
    ............................................................
    3661cttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagg3720
    3661gaacaaggtttgaccttgttgtgagttgggatagagccagataagaaaactaaatattcc3720
    f1_origin..................................................
    ............................................................
    3721gattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgc3780
    3721ctaaaacggctaaagccggataaccaattttttactcgactaaattgtttttaaattgcg3780
    ............................................................
    ............................................................
    3781gaattttaacaaaatattaacgcttacaatttaggtggcacttttcggggaaatgtgcgc3840
    3781cttaaaattgttttataattgcgaatgttaaatccaccgtgaaaagcccctttacacgcg3840
    ............................................................
    ............................................................
    3841ggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaa3900
    3841ccttggggataaacaaataaaaagatttatgtaagtttatacataggcgagtactctgtt3900
    ........................................ AmpR_pro..........
    ............................................................
    3901taaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttc3960
    3901attgggactatttacgaagttattataactttttccttctcatactcataagttgtaaag3960
    ............................................... ORF 1 Ampicillin
    ............................................................
    3961cgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaa4020
    3961gcacagcgggaataagggaaaaaacgccgtaaaacggaaggacaaaaacgagtgggtctt4020
    ................. ORF 1 Ampicillin...........................
    ............................................................
    4021acgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaa4080
    4021tgcgaccactttcattttctacgacttctagtcaacccacgtgctcacccaatgtagctt4080
    ................. ORF 1 Ampicillin...........................
    ............................................................
    4081ctggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatg4140
    4081gacctagagttgtcgccattctaggaactctcaaaagcggggcttcttgcaaaaggttac4140
    ................. ORF 1 Ampicillin...........................
    ............................................................
    4141atgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaa4200
    4141tactcgtgaaaatttcaagacgatacaccgcgccataatagggcataactgcggcccgtt4200
    ................. ORF 1 Ampicillin...........................
    ............................................................
    4201gagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtc4260
    4201ctcgttgagccagcggcgtatgtgataagagtcttactgaaccaactcatgagtggtcag4260
    ................. ORF 1 Ampicillin...........................
    ............................................................
    4261acagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataacc4320
    4261tgtcttttcgtagaatgcctaccgtactgtcattctcttaatacgtcacgacggtattgg4320
    ................. ORF 1 Ampicillin...........................
    ............................................................
    4321atgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagcta4380
    4321tactcactattgtgacgccggttgaatgaagactgttgctagcctcctggcttcctcgat4380
    ................. ORF 1 Ampicillin...........................
    ............................................................
    4381accgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggag4440
    4381tggcgaaaaaacgtgttgtaccccctagtacattgagcggaactagcaacccttggcctc4440
    ................. ORF 1 Ampicillin...........................
    ............................................................
    4441ctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaaca4500
    4441gacttacttcggtatggtttgctgctcgcactgtggtgctacggacatcgttaccgttgt4500
    ................. ORF 1 Ampicillin...........................
    ............................................................
    4501acgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaata4560
    4501tgcaacgcgtttgataattgaccgcttgatgaatgagatcgaagggccgttgttaattat4560
    ................. ORF 1 Ampicillin...........................
    ............................................................
    4561gactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggc4620
    4561ctgacctacctccgcctatttcaacgtcctggtgaagacgcgagccgggaaggccgaccg4620
    ................. ORF 1 Ampicillin...........................
    ............................................................
    4621tggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagca4680
    4621accaaataacgactatttagacctcggccactcgcacccagagcgccatagtaacgtcgt4680
    ................. ORF 1 Ampicillin...........................
    ............................................................
    4681ctggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggca4740
    4681gaccccggtctaccattcgggagggcatagcatcaatagatgtgctgcccctcagtccgt4740
    ................. ORF 1 Ampicillin...........................
    ............................................................
    4741actatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattgg4800
    4741tgatacctacttgctttatctgtctagcgactctatccacggagtgactaattcgtaacc4800
    ................. ORF 1 Ampicillin...........................
    ............................................................
    4801taactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaa4860
    4801attgacagtctggttcaaatgagtatatatgaaatctaactaaattttgaagtaaaaatt4860
    ............................................................
    ............................................................
    4861tttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgt4920
    4861aaattttcctagatccacttctaggaaaaactattagagtactggttttagggaattgca4920
    ............................................................
    ............................................................
    4921gagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagat4980
    4921ctcaaaagcaaggtgactcgcagtctggggcatcttttctagtttcctagaagaactcta4980
    ...................................... pBR322_origin........
    ............................................................
    4981cctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtg5040
    4981ggaaaaaaagacgcgcattagacgacgaacgtttgtttttttggtggcgatggtcgccac5040
    .................. pBR322_origin............................
    ............................................................
    5041gtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcaga5100
    5041caaacaaacggcctagttctcgatggttgagaaaaaggcttccattgaccgaagtcgtct5100
    .................. pBR322_origin............................
    ............................................................
    5101gcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaac5160
    5101cgcgtctatggtttatgacaggaagatcacatcggcatcaatccggtggtgaagttcttg5160
    .................. pBR322_origin............................
    ............................................................
    5161tctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagt5220
    5161agacatcgtggcggatgtatggagcgagacgattaggacaatggtcaccgacgacggtca5220
    .................. pBR322_origin............................
    ............................................................
    5221ggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcag5280
    5221ccgctattcagcacagaatggcccaacctgagttctgctatcaatggcctattccgcgtc5280
    .................. pBR322_origin............................
    ............................................................
    5281cggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacacc5340
    5281gccagcccgacttgccccccaagcacgtgtgtcgggtcgaacctcgcttgctggatgtgg5340
    .................. pBR322_origin............................
    ............................................................
    5341gaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaag5400
    5341cttgactctatggatgtcgcactcgatactctttcgcggtgcgaagggcttccctctttc5400
    .................. pBR322_origin............................
    ............................................................
    5401gcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttcca5460
    5401cgcctgtccataggccattcgccgtcccagccttgtcctctcgcgtgctccctcgaaggt5460
    .................. pBR322_origin............................
    ............................................................
    5461gggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgt5520
    5461ccccctttgcggaccatagaaatatcaggacagcccaaagcggtggagactgaactcgca5520
    .................. pBR322_origin............................
    ............................................................
    5521cgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcc5580
    5521gctaaaaacactacgagcagtccccccgcctcggatacctttttgcggtcgttgcgccgg5580
    .................. pBR322_origin............................
    ............................................................
    5581tttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcc5640
    5581aaaaatgccaaggaccggaaaacgaccggaaaacgagtgtacaagaaaggacgcaatagg5640
    ............................................................
    ............................................................
    5641cctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagc5700
    5641ggactaagacacctattggcataatggcggaaactcactcgactatggcgagcggcgtcg5700
    ............................................................
    ............................................................
    5701cgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaa5760
    5701gcttgctggctcgcgtcgctcagtcactcgctccttcgccttctcgcgggttatgcgttt5760
    ............................................................
    ............................................................
    5761ccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgac5820
    5761ggcggagaggggcgcgcaaccggctaagtaattacgtcgaccgtgctgtccaaagggctg5820
    ............................................................
    ............................................................
    5821tggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccc5880
    5821acctttcgcccgtcactcgcgttgcgttaattacactcaatcgagtgagtaatccgtggg5880
    ............................................................
    ............................................................
    5881caggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaa5940
    5881gtccgaaatgtgaaatacgaaggccgagcatacaacacaccttaacactcgcctattgtt5940
    .......... lac.............................. M13_pUC_r
    ............................................................
    5941tttcacacaggaaacagctatgaccatgattacgccaagcgcgcaattaaccctcactaa6000
    5941aaagtgtgtcctttgtcgatactggtactaatgcggttcgcgcgttaattgggagtgatt6000
    M13_pUC_r M13_r.............................. T3
    ......... BglII(6020).......................................
    6001agggaacaaaagctggtcgagatctagc................................6028
    6001tcccttgttttcgaccagctctagatcg................................6028
    T3..................................................

    References



  • Copyright 2005 BVTech, Inc. All Rights Reserved