image of the BVTech Plasmid
Search plasmid maps in this site
Google
Web biovisualtech.com
More Plasmid Map Templates
  • Adenoviral
  • Bacterial expression
  • Cre/Lox
  • Insect expression
  • Lentiviral
  • Luciferase
  • Mammalian expression
  • Other
  • Retroviral
  • RNAi
  • Worm expression
  • Yeast expression
  • Bacterial vectors
  • Mammalian
  • Recent Release from EMBL
  • Free Software Downloads
    BVTech Photo Publisher
    Help you publish your pictures over the Internet or a local network so that other people can view them in their Web browsers
    HealthWatch
    A virtual apple a day to keep the doctor away
    Download VisualSniffer 2.0
    VisualSniffer is a powerful packet capture tool and protocol analyzer
    BVTech Plasmid
    A plasmid drawing software
    Download Growth Chart SDK to integrate the functionality of Growth Charts from HealthWatch Pro into your business applications

    Plasmid map of pGEX-6P-3

    Download the plasmid map
    Use BVTech Plasmid to view and edit this plasmid map.

    Dowload BVTech Plasmid
    If you do not have BVTech Plasmid, download the latest version of BVTech Plasmid here.

    BVTech Plasmid is DNA sequence analysis and plasmid drawing software for Windows PCs. You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your DNA sequencing data, align sequences, and much more.

    Free to try, $39.98 to buy

    Payments will be processed by PayPal. PayPal is the safer, easier way to pay.

    View the sequence with features on line
    pGEX-6P-3
    Vendor:Amersham
    Vector Type: Bacterial
    Viral/Non-viral: Nonviral
    Stable/Transient: Transient
    Constitutive/Inducible: Constitutive
    Promoter: tac
    Expression Level: High (activate with IPTG)
    Backbone size: 4900
    Sequencing Primer: pGEX Fwd
    Sequencing Primer Sequence: 5'd[GGGCTGGCAAGCCACGTTTGGTG]3'
    Tag: GST (Nterm)
    Bacteria Resistance: Ampicillin
    Mammalian Selection: N/a
    Catalog Number: 27-4599-01
    Comments:PreScission� cleavage site allows cleavage at low temps



    image of pGEX-6P-3



    Copyright 2005 BVTech, Inc. All Rights Reserved