image of the BVTech Plasmid
Search plasmid maps in this site
Google
Web biovisualtech.com
More Plasmid Map Templates
  • Adenoviral
  • Bacterial expression
  • Cre/Lox
  • Insect expression
  • Lentiviral
  • Luciferase
  • Mammalian expression
  • Other
  • Retroviral
  • RNAi
  • Worm expression
  • Yeast expression
  • Bacterial vectors
  • Mammalian
  • Recent Release from EMBL
  • Free Software Downloads
    BVTech Photo Publisher
    Help you publish your pictures over the Internet or a local network so that other people can view them in their Web browsers
    HealthWatch
    A virtual apple a day to keep the doctor away
    Download VisualSniffer 2.0
    VisualSniffer is a powerful packet capture tool and protocol analyzer
    BVTech Plasmid
    A plasmid drawing software
    Download Growth Chart SDK to integrate the functionality of Growth Charts from HealthWatch Pro into your business applications

    Plasmid map of pIS0

    Download the plasmid map
    Use BVTech Plasmid to view and edit this plasmid map.

    Dowload BVTech Plasmid
    If you do not have BVTech Plasmid, download the latest version of BVTech Plasmid here.

    BVTech Plasmid is DNA sequence analysis and plasmid drawing software for Windows PCs. You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your DNA sequencing data, align sequences, and much more.

    Free to try, $39.98 to buy

    Payments will be processed by PayPal. PayPal is the safer, easier way to pay.

    View the sequence with features on line
    Vector backbone: pIS0
    Backbone manufacturer: Bartel Lab
    Type of vector: Mammalian expression,Luciferase
    Backbone size (bp): 5264
    5' Sequencing primer: n/a
    3' Sequencing primer: EBV rev primer (GTGGTTTGTCCAAACTCATC)
    Bacteria resistance: Ampicillin
    High or low copy: High Copy
    Grow in standard E. coli @ 37C: Yes
    Plasmid Provided In: DH5a
    Principal Investigator: David Bartel
    Comments: The firefly luciferase vector was modified from pGL3 Control Vector (Promega), such that a short sequence containing multiple cloning sites (5'-AGCTCTATACGCGTCTCAAGCTTACTGCTAGC GT-3') was inserted into the XbaI site immediately downstream from the stop codon. 3'UTR segments of target genes can be inserted into this vector to test for their effects on mRNA stability.
    Article: MicroRNA-directed cleavage of HOXB8 mRNA. Yekta S et al. (Science. 2004 Apr 23. 304(5670):594-6. Pubmed)



    image of pIS0



    Copyright 2005 BVTech, Inc. All Rights Reserved