Vector backbone: pIS1
Backbone manufacturer: Bartel Lab
Type of vector: Mammalian expression,Luciferase
Backbone size (bp): 4085
5' Sequencing primer: n/a
3' Sequencing primer: EBV rev primer (GTGGTTTGTCCAAACTCATC)
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
Plasmid Provided In: DH5a
Principal Investigator: David Bartel
Comments: pIS1 was derived from pRL-TK by adding more cloning sites. The plasmid contains a renilla luciferase reporter driven by the HSV TK promoter. Search Addgene's vector database for more information on pRL-TK from Promega.