Vector backbone: pIS2
Backbone manufacturer: David Bartel Lab
Type of vector: Mammalian expression,Luciferase
Backbone size (bp): 3745
5' Sequencing primer: EBV rev primer (GTGGTTTGTCCAAACTCATC) (List of Sequencing Primers)
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
Plasmid Provided In: DH5a
Principal Investigator: David Bartel
Comments: pIS2 was derived from pRL-SV40. More cloning sites have been added (the lower case is the pRL-SV40 and the caps is the new sequence that has been inserted): gaacaataattctagGAGCTCTATACCGGTCT CGATATCACTACTAGTGTtctagagcggccgc t . The plasmid contains a renilla luciferase reporter driven by the SV40 early enhancer/promoter.
Article: The widespread impact of mammalian MicroRNAs on mRNA repression and evolution. Farh KK et al. (Science. 2005 Dec 16. 310(5755):1817-21. Pubmed)