Download the plasmid map Use BVTech Plasmid to view and edit this plasmid map. Dowload BVTech Plasmid If you do not have BVTech Plasmid, download the latest version of BVTech Plasmid here. BVTech Plasmid is DNA sequence analysis and plasmid drawing software for Windows PCs. You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your DNA sequencing data, align sequences, and much more. Free to try, $39.98 to buy Payments will be processed by PayPal. PayPal is the safer, easier way to pay.

View the sequence with features on line
pIZ/V5-His
Vendor: Invitrogen
Vector Type: Insect
Viral/Non-viral: Viral
Stable/Transient: Stable
Constitutive/Inducible: Constitutive
Promoter: OpIE2
Backbone Size (bp): 2900
Sequencing Primer: OpIE2
Sequencing Primer Sequence: 5'd[CGCAACGATCTGGTAAACAC]3'
Tag: V5 (Cterm), His (Cterm)
Bacteria Resistance: Ampicillin
Mammalian Selection: Zeocin
Catalog Number: V800001, K80501, K80001
Comments: Stable expression of gene in insect cells.