jBjBID PJRTAC99 preliminary; circular DNA; SYN; 1392 BP. XX AC X69551; ATCC87018; XX DT 01-OCT-1993 (Rel. 7, Created) DT 01-JUL-1995 (Rel. 12, Last updated, Version 1) XX DE E. coli plasmid vector pJRtac99 - complete. XX KW cloning vector. XX OS Cloning vector OC Artificial sequences; Cloning vehicles. XX RN [1] RP 1-1392 RC pJRtac99 from Tn9 & pDR540 & pGV451, HyRep2 ori RA Robben J., Massie G., Bosmans E., Wellens B., Volckaert G.; RT "An Escherichia coli plasmid vector system for high-level production RT and purification of heterologous peptides fused to active RT chloramphenicol acetyltransferase"; RL Gene 126:109-113(1993). XX RN [2] RC pJRtac99 from Tn9 & pDR540 & pGV451, HyRep2 ori RA Dekeyzer N., Volckaert G.N.; RT "Cloning, expression and purification of a sarcoplasmic RT calcium-binding protein from the sandworm Nereis diversicolor via RT a fusion product with chloramphenicol acetyltransferase"; RL Protein Engineering 7:125-130(1994). XX CC MCS. oligonucleotide linker. in GenBank. CC Restriction digests of the clone give the following sizes (kb): CC EcoRI--1.3; HindIII--1.3; BglII--1.3. (ATCC staff) CC Expression vector permitting production of heterologous peptides CC fused to active chloramphenicol acetyltransferase. The replicon is CC derived from ColE1 and does not contain the RNAII promoter nor most of CC the antisense RNAI control element coding sequence. This allows CC compatibility with other ColE1 plasmids. Replication depends on CC read-through from the tac promoter. Replication may be negatively CC affected by cloning of large inserts or sequences containing a CC transcriptional terminator. Repression of this high copy number CC plasmid is hard to achieve, even using hosts overproducing lacIq. CC Escherichia coli WK6 is recommended for inducible expression. CC The vector contains CC the following restriction sites (approximate kb from nt 1): CC BglII--0.79; ClaI--0.11; EcoRI--0.33; HindIII--0.02; NcoI--0.12; CC PstI--0.75; PvuII--0.23. The order of the major features of the CC plasmid is: HindIII - tac promoter - NcoI - cat/ScaI/MCS/BglII - CC HyRep2 ori. [1] CC Growth: LB plus chloramphenicol (25 ug/ml) 37C CC Deposited by: Robben J.N., Volckaert G.N. CC NM (pJRtac99) CC CM (yes) CC NA (ds-DNA) CC TP (circular) CC ST () CC TY (plasmid) CC SP (ATCC) CC HO (E.coli)(E.coli BMH71-18) CC CP () CC FN (cloning)(expression)(fusion) CC SE () CC PA (pGV451 from pBR327) CC BR () CC OF () CC OR () XX FH Key Location/Qualifiers FH FT misc_feature 0..0 FT /note="1. pDR540, tac promoter 4063bp- FT 2. pGV451, HyRep2 ori [from ColE1 ori] FT -> plasmid FT 1. plasmid 566bp, HyRep2 ori [from ColE1 ori] FT 2. Tn9 TaqI-TaqI 773bp 215..988, cat gene/#V00622 FT -> plasmid2 1339bp FT 1. plasmid2 ScaI 1339bp 992..992, FT \ Tn9 cat gene or pGV451 FT 2. oligo MCS 53bp FT \ agtactgcagcgtcgaccagggacccgggtaatgaagagtaactagatct FT \ act FT -> pJRtac99 1392bp" FT misc_binding 0..0 FT /note="SIT HindIII" FT promoter 20..115 FT /note="PRO E. coli tac" FT misc_binding 0..0 FT /note="SIT NcoI" FT CDS 121..780 FT /note="ANT E. coli chloramphenicol acetyltransferase FT gene (CAT) chloramphenicol resistance gene, mutant, FT EXPERIMENTAL" FT misc_binding 752..798 FT /note="MCS ScaI-PstI-SalI/AccI-EcoO1091-AvaII- FT XmaI/SmaI/AvaI-EarI-BglII/BstYI FT EXPERIMENTAL" FT rep_origin 912..1392 FT /note="ORI E. coli HyRep2, from pBR327 ColE1" XX SQ Sequence 1392 BP; 361 A; 325 C; 359 G; 347 T; 0 other; acgccagcaa cgcggcccga agcttactcc ccatccccct gttgacaatt aatcatcggc tcgtataatg tgtggaattg tgagcggata acaatttcac acaggaaaca ggatcgatcc atggagaaaa aaatcactgg atataccacc gttgatatat cccaatggca tcgtaaagaa cattttgagg catttcagtc agttgctcaa tgtacctata accagaccgt tcagctggat attacggcct ttttaaagac cgtaaagaaa aataagcaca agttttatcc ggcctttatt cacattcttg cccgcctgat gaatgctcat ccggaattcc gtatggcaat gaaagacggt gagctggtga tatgggatag tgttcaccct tgttacaccg ttttccatga gcaaactgaa acgttttcat cgctctggag tgaataccac gacgatttcc ggcagtttct acacatatat tcgcaagatg tggcgtgtta cggtgaaaac ctggcctatt tccctaaagg gtttattgag aatatgtttt tcgtctcagc caatccctgg gtgagtttca ccagttttga tttaaacgtg gccaatatgg acaacttctt cgcccccgtt ttcacaatgg gcaaatatta tacgcaaggc gacaaggtgc tgatgccgct ggcgattcag gttcatcatg ccgtttgtga tggcttccat gtcggcagaa tgcttaatga attacaacag tactgcagcg tcgaccaggg acccgggtaa tgaagagtaa ctagatctac tgcgatgagt ggcagggcgg ggcgtaattt ttttaaggca gttattggtg cccttaaacg cctggtgcta cgcctgaata agtgataata agcggatgaa tggcagaaat tcgaactggc ttcagcagag cgcagatacc aaatactgtc cttctagtgt agccgtagtt aggccaccac ttcaagaact ctgtagcacc gcctacatac ctcgctctgc taatcctgtt accagtggct gctgccagtg gcgataagtc gtgtcttacc gggttggact caagacgata gttaccggat aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac agcccagctt ggagcgaacg acctacaccg aactgagata cctacagcgt gagcattgag aaagcgccac gcttcccgaa gggagaaagg cggacaggta tccggtaagc ggcagggtcg gaacaggaga gcgcacgagg gagcttccag ggggaaacgc ctggtatctt tatagtcctg tcgggtttcg ccacctctga cttgagcgtc gatttttgtg atgctcgtca ggggggcgga gcctatggaa aa // p pJRtac99 "Times New RomanjBCp.G tac_promoter"Times New Roman<jBCp pBR322_origin"Times New RomanjBCpSiM13_pUC_rev_primer"Times New Roman<jBCɆpy  Orf frame 1"Times New Roman<jBpy;CAT/CamR(w/ gaps)"Times New Roman jBHindIII"Times New RomanpjVzC:4zC jBAseI"Times New Roman1pnZF7F jBClaI(114), NcoI(119)"Times New RomanrpqcE1c jBPvuII"Times New Roman p&7HH jBEcoRI"Times New RomanNp@#T!gg& jBMscI"Times New RomanY p   jBPstl(757), SalI(760)"Times New RomanpC=SS3 jBSmaI"Times New Romanp5/( E jBBglII"Times New Roman p%   jBBstBI"Times New Roman pw jBApaLI"Times New RomanmpU