image of the BVTech Plasmid
Search plasmid maps in this site
Google
Web biovisualtech.com
More Plasmid Map Templates
  • Adenoviral
  • Bacterial expression
  • Cre/Lox
  • Insect expression
  • Lentiviral
  • Luciferase
  • Mammalian expression
  • Other
  • Retroviral
  • RNAi
  • Worm expression
  • Yeast expression
  • Bacterial vectors
  • Mammalian
  • Recent Release from EMBL
  • BVTech Plasmid

    This sequnce graph is created using BVTech Plasmid, which is DNA sequence analysis and plasmid drawing software for Windows PCs.You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your DNA sequencing data, align sequences, and much more.

    Free to try, $39.98 to buy

    Payments will be processed by PayPal. PayPal is the safer, easier way to pay.

    Sequence of pPD95_75

  • Download the sequence and plasmid map, and then use BVTech Plasmid to view and edit the file.
  • If you do not have BVTech Plasmid, download the latest version of BVTech Plasmid here.
  • View the plasmid map on line

    Sequence of pPD95_75 : 4487 BP; 1265 A; 981 C; 1002 G; 1239 T; 0 other;

    HindIII(1) PstI(17) XbaI(25) BamHI(31) SmaI(38)............
    1aagcttgcatgcctgcaggtcgactctagaggatccccgggattggccaaaggacccaaa60
    1ttcgaacgtacggacgtccagctgagatctcctaggggccctaaccggtttcctgggttt60
    ............................................................
    ............................................................
    61ggtatgtttcgaatgatactaacataacatagaacattttcaggaggacccttggagggt120
    61ccatacaaagcttactatgattgtattgtatcttgtaaaagtcctcctgggaacctccca120
    .................... SynIVS.A..............................
    AgeI(121),KpnI(122)........................................
    121accggtagaaaaaatgagtaaaggagaagaacttttcactggagttgtcccaattcttgt180
    121tggccatcttttttactcatttcctcttcttgaaaagtgacctcaacagggttaagaaca180
    .......................... GFP(w/ gaps) ORF 2................
    ............................................................
    181tgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagg gtgaaggtga240
    181acttaatctaccactacaattacccgtgtttaaaagacagtcacctctcccacttccact240
    ................ GFP(w/ gaps) ORF 2..........................
    .................................................. NcoI(299)
    241tgcaacatacggaaaacttacccttaaatttatttgcactactggaaaac tacctgttcc300
    241acgttgtatgccttttgaatgggaatttaaataaacgtgatgaccttttgatggacaagg300
    ................ GFP(w/ gaps) ORF 2..........................
    ............................................................
    301atgggtaagtttaaacatatatatactaactaaccctgattatttaaattttcagccaac360
    301tacccattcaaatttgtatatatatgattgattgggactaataaatttaaaagtcggttg360
    ................ GFP(w/ gaps) ORF 2 SynIVSR.................
    .............................. XhoI(397)....................
    361acttgtcactactttctgttatggtgttcaatgcttctcgagatacccagatcatatgaa420
    361tgaacagtgatgaaagacaataccacaagttacgaagagctctatgggtctagtatactt420
    ............ GFP(w/ gaps) ORF 2 gfp.S65C......................
    ............................................................
    421acggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaa gaactatatt480
    421tgccgtactgaaaaagttctcacggtacgggcttccaatacatgtcctttcttgatataa480
    ................ GFP(w/ gaps) ORF 2..........................
    ............................................................
    481tttcaaagatgacgggaactacaagacacgtaagtttaaacagttcggtactaactaacc540
    481aaagtttctactgcccttgatgttctgtgcattcaaatttgtcaagccatgattgattgg540
    ................ GFP(w/ gaps) ORF 2...... SynIVS.S..........
    ............................................................
    541atacatatttaaattttcaggtgctgaagtcaagtttgaaggtgatacccttgttaatag600
    541tatgtataaatttaaaagtccacgacttcagttcaaacttccactatgggaacaattatc600
    SynIVS.S...... GFP(w/ gaps) ORF 2..........................
    ............................................................
    601aatcgagttaaaaggtattgattttaaagaagatggaaacattcttggac acaaattgga660
    601ttagctcaattttccataactaaaatttcttctacctttgtaagaacctgtgtttaacct660
    ................ GFP(w/ gaps) ORF 2..........................
    ............................................................
    661atacaactataactcacacaatgtatacatcatggcagacaaacaaaaga atggaatcaa720
    661tatgttgatattgagtgtgttacatatgtagtaccgtctgtttgttttcttaccttagtt720
    ................ GFP(w/ gaps) ORF 2..........................
    ............................................................
    < td>gatttaaatt
    721agttgtaagtttaaacatgattttactaactaactaatctttcagaactt780
    721tcaacattcaaatttgtactaaaatgattgattgattagactaaatttaaaagtcttgaa780
    ............ GFP(w/ gaps) ORF 2 SynIVS.T......................
    ............................................................
    781caaaattagacacaacattgaagatggaagcgttcaactagcagaccatt atcaacaaaa840
    781gttttaatctgtgttgtaacttctaccttcgcaagttgatcgtctggtaatagttgtttt840
    ................ GFP(w/ gaps) ORF 2..........................
    ............................................................
    841tactccaattggcgatggccctgtccttttaccagacaaccattacctgt ccacacaatc900
    841atgaggttaaccgctaccgggacaggaaaatggtctgttggtaatggacaggtgtgttag900
    ................ GFP(w/ gaps) ORF 2..........................
    ............................................................
    901tgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttg agtttgtaac960
    901acgggaaagctttctagggttgcttttctctctggtgtaccaggaagaactcaaacattg960
    ................ GFP(w/ gaps) ORF 2..........................
    ................................................. EcoRI(1012)
    961agctgctgggattacacatggcatggatgaactatacaaatagcattcgtagaattccaa1020
    961tcgacgaccctaatgtgtaccgtacctacttgatatgtttatcgtaagcatcttaaggtt1020
    ......... GFP(w/ gaps) ORF 2.............................
    ............................................................
    1021ctgagcgccggtcgctaccattaccaacttgtctggtgtcaaaaataataggggccgctg1080
    1021gactcgcggccagcgatggtaatggttgaacagaccacagtttttattatccccggcgac1080
    ............................................................
    ............................................................
    1081tcatcagagtaagtttaaactgagttctactaactaacgagtaatatttaaattttcagc1140
    1081agtagtctcattcaaatttgactcaagatgattgattgctcattataaatttaaaagtcg1140
    .............................. SynIVS.L....................
    ............................................................
    1141atctcgcgcccgtgcctctgacttctaagtccaattactcttcaacatccctacatgctc1200
    1141tagagcgcgggcacggagactgaagattcaggttaatgagaagttgtagggatgtacgag1200
    ............................................................
    ............................................................
    1201tttctccctgtgctcccaccccctatttttgttattatcaaaaaacttctcttaatttct1260
    1201aaagagggacacgagggtgggggataaaaacaataatagttttttgaagagaattaaaga1260
    ............................................................
    ............................................................
    1261ttgttttttagcttcttttaagtcacctctaacaatgaaattgtgtagattcaaaaatag1320
    1261aacaaaaaatcgaagaaaattcagtggagattgttactttaacacatctaagtttttatc1320
    ............................................................
    ............................................................
    1321aattaattcgtaataaaaagtcgaaaaaaattgtgctccctccccccattaataataatt1380
    1321ttaattaagcattatttttcagctttttttaacacgagggaggggggtaattattattaa1380
    ............................................................
    ............................................................
    1381ctatcccaaaatctacacaatgttctgtgtacacttcttatgttttttacttctgataaa1440
    1381gatagggttttagatgtgttacaagacacatgtgaagaatacaaaaaatgaagactattt1440
    ............................................................
    ............................................................
    1441tttttttgaaacatcatagaaaaaaccgcacacaaaataccttatcatatgttacgtttc1500
    1441aaaaaaactttgtagtatcttttttggcgtgtgttttatggaatagtatacaatgcaaag1500
    ............................................................
    ............................................................
    1501agtttatgaccgcaatttttatttcttcgcacgtctgggcctctcatgacgtcaaatcat1560
    1501tcaaatactggcgttaaaaataaagaagcgtgcagacccggagagtactgcagtttagta1560
    ............................................................
    ............................................................
    1561gctcatcgtgaaaaagttttggagtatttttggaatttttcaatcaagtgaaagtttatg1620
    1561cgagtagcactttttcaaaacctcataaaaaccttaaaaagttagttcactttcaaatac1620
    ............................................................
    ............................................................
    1621aaattaattttcctgcttttgctttttggggtttcccctattgtttgtcaagatttcgag1680
    1621tttaattaaaaggacgaaaacgaaaaaccccaaaggggataacaaacagttctaaagctc1680
    ............................................................
    ............................................................
    1681gacggcgtttttcttgctaaaatcacaagtattgatgagcacgatgcaagaaagatcgga1740
    1681ctgccgcaaaaagaacgattttagtgttcataactactcgtgctacgttctttctagcct1740
    ............................................................
    ............................................................
    1741agaaggtttgggtttgaggctcagtggaaggtgagtagaagttgataatttgaaagtgga1800
    1741tcttccaaacccaaactccgagtcaccttccactcatcttcaactattaaactttcacct1800
    ............................................................
    ............................................................
    1801gtagtgtctatggggtttttgccttaaatgacagaatacattcccaatataccaaacata1860
    1801catcacagataccccaaaaacggaatttactgtcttatgtaagggttatatggtttgtat1860
    ............................................................
    .................... ApaI(1890)..............................
    1861actgtttcctactagtcggccgtacgggccctttcgtctcgcgcgtttcggtgatgacgg1920
    1861tgacaaaggatgatcagccggcatgcccgggaaagcagagcgcgcaaagccactactgcc1920
    ............................................................
    ............................................................
    1921tgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgc1980
    1921acttttggagactgtgtacgtcgagggcctctgccagtgtcgaacagacattcgcctacg1980
    ............................................................
    ............................................................
    1981cgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggctggct2040
    1981gccctcgtctgttcgggcagtcccgcgcagtcgcccacaaccgcccacagccccgaccga2040
    ............................................................
    ............................................................
    2041taactatgcggcatcagagcagattgtactgagagtgcaccatatgcggtgtgaaatacc2100
    2041attgatacgccgtagtctcgtctaacatgactctcacgtggtatacgccacactttatgg2100
    ............................................................
    ............................................................
    2101gcacagatgcgtaaggagaaaataccgcatcaggcggccttaagggcctcgtgatacgcc2160
    2101cgtgtctacgcattcctcttttatggcgtagtccgccggaattcccggagcactatgcgg2160
    ............................................................
    ............................................................
    2161tatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttc2220
    2161ataaaaatatccaattacagtactattattaccaaagaatctgcagtccaccgtgaaaag2220
    ............................................................
    ............................................................
    2221ggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatc2280
    2221cccctttacacgcgccttggggataaacaaataaaaagatttatgtaagtttatacatag2280
    .................................................. Amp_pro
    ............................................................
    2281cgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatga2340
    2281gcgagtactctgttattgggactatttacgaagttattataactttttccttctcatact2340
    Amp_pro..................................................
    ............................................................
    2341gtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgttt2400
    2341cataagttgtaaaggcacagcgggaataagggaaaaaacgccgtaaaacggaaggacaaa2400
    ................. ORF 3 Ampicillin...........................
    ............................................................
    2401ttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgag2460
    2401aacgagtgggtctttgcgaccactttcattttctacgacttctagtcaacccacgtgctc2460
    ................. ORF 3 Ampicillin...........................
    ............................................................
    2461tgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaag2520
    2461acccaatgtagcttgacctagagttgtcgccattctaggaactctcaaaagcggggcttc2520
    ................. ORF 3 Ampicillin...........................
    ............................................................
    2521aacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgta2580
    2521ttgcaaaaggttactactcgtgaaaatttcaagacgatacaccgcgccataatagggcat2580
    ................. ORF 3 Ampicillin...........................
    ............................................................
    2581ttgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttg2640
    2581aactgcggcccgttctcgttgagccagcggcgtatgtgataagagtcttactgaaccaac2640
    ................. ORF 3 Ampicillin...........................
    ............................................................
    2641agtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgca2700
    2641tcatgagtggtcagtgtcttttcgtagaatgcctaccgtactgtcattctcttaatacgt2700
    ................. ORF 3 Ampicillin...........................
    ............................................................
    2701gtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggag2760
    2701cacgacggtattggtactcactattgtgacgccggttgaatgaagactgttgctagcctc2760
    ................. ORF 3 Ampicillin...........................
    ............................................................
    2761gaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatc2820
    2761ctggcttcctcgattggcgaaaaaacgtgttgtaccccctagtacattgagcggaactag2820
    ................. ORF 3 Ampicillin...........................
    ............................................................
    2821gttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctg2880
    2821caacccttggcctcgacttacttcggtatggtttgctgctcgcactgtggtgctacggac2880
    ................. ORF 3 Ampicillin...........................
    .................... FspI(2901)..............................
    2881tagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttccc2940
    2881atcgttaccgttgttgcaacgcgtttgataattgaccgcttgatgaatgagatcgaaggg2940
    ................. ORF 3 Ampicillin...........................
    ............................................................
    2941ggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcgg3000
    2941ccgttgttaattatctgacctacctccgcctatttcaacgtcctggtgaagacgcgagcc3000
    ................. ORF 3 Ampicillin...........................
    ............................................................
    3001cccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcg3060
    3001gggaaggccgaccgaccaaataacgactatttagacctcggccactcgcacccagagcgc3060
    ................. ORF 3 Ampicillin...........................
    ............................................................
    3061gtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacga3120
    3061catagtaacgtcgtgaccccggtctaccattcgggagggcatagcatcaatagatgtgct3120
    ................. ORF 3 Ampicillin...........................
    ............................................................
    3121cggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcac3180
    3121gcccctcagtccgttgatacctacttgctttatctgtctagcgactctatccacggagtg3180
    ................. ORF 3 Ampicillin...........................
    ............................................................
    3181tgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaa3240
    3181actaattcgtaaccattgacagtctggttcaaatgagtatatatgaaatctaactaaatt3240
    ORF 3 Ampicillin............................................
    ............................................................
    3241aacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgacca3300
    3241ttgaagtaaaaattaaattttcctagatccacttctaggaaaaactattagagtactggt3300
    ............................................................
    ............................................................
    3301aaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaag3360
    3301tttagggaattgcactcaaaagcaaggtgactcgcagtctggggcatcttttctagtttc3360
    ................................................ pBR322_origin
    ............................................................
    3361gatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccac3420
    3361ctagaagaactctaggaaaaaaagacgcgcattagacgacgaacgtttgtttttttggtg3420
    .................. pBR322_origin............................
    ............................................................
    3421cgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaa3480
    3421gcgatggtcgccaccaaacaaacggcctagttctcgatggttgagaaaaaggcttccatt3480
    .................. pBR322_origin............................
    ............................................................
    3481ctggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggcc3540
    3481gaccgaagtcgtctcgcgtctatggtttatgacaggaagatcacatcggcatcaatccgg3540
    .................. pBR322_origin............................
    ............................................................
    3541accacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccag3600
    3541tggtgaagttcttgagacatcgtggcggatgtatggagcgagacgattaggacaatggtc3600
    .................. pBR322_origin............................
    ............................................................
    3601tggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttac3660
    3601accgacgacggtcaccgctattcagcacagaatggcccaacctgagttctgctatcaatg3660
    .................. pBR322_origin............................
    ............................................................
    3661cggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagc3720
    3661gcctattccgcgtcgccagcccgacttgccccccaagcacgtgtgtcgggtcgaacctcg3720
    .................. pBR322_origin............................
    ............................................................
    3721gaacgacctacaccgaactgagatacctacagcgtgagcattgagaaagcgccacgcttc3780
    3721cttgctggatgtggcttgactctatggatgtcgcactcgtaactctttcgcggtgcgaag3780
    .................. pBR322_origin............................
    ............................................................
    3781ccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgca3840
    3781ggcttccctctttccgcctgtccataggccattcgccgtcccagccttgtcctctcgcgt3840
    .................. pBR322_origin............................
    ............................................................
    3841cgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacc3900
    3841gctccctcgaaggtccccctttgcggaccatagaaatatcaggacagcccaaagcggtgg3900
    .................. pBR322_origin............................
    ............................................................
    3901tctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacg3960
    3901agactgaactcgcagctaaaaacactacgagcagtccccccgcctcggatacctttttgc3960
    .................. pBR322_origin............................
    ............................................................
    3961ccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttct4020
    3961ggtcgttgcgccggaaaaatgccaaggaccggaaaacgaccggaaaacgagtgtacaaga4020
    pBR322_origin..............................................
    ............................................................
    4021ttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgata4080
    4021aaggacgcaataggggactaagacacctattggcataatggcggaaactcactcgactat4080
    ............................................................
    ............................................................
    4081ccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagc4140
    4081ggcgagcggcgtcggcttgctggctcgcgtcgctcagtcactcgctccttcgccttctcg4140
    ............................................................
    ............................................................
    4141gcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacg4200
    4141cgggttatgcgtttggcggagaggggcgcgcaaccggctaagtaattacgtcgaccgtgc4200
    .................................................. lacI.C
    ............................................................
    4201acaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctca4260
    4201tgtccaaagggctgacctttcgcccgtcactcgcgttgcgttaattacactcaatcgagt4260
    lacI.C..................................................
    ............................................................
    4261ctcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattg4320
    4261gagtaatccgtggggtccgaaatgtgaaatacgaaggccgagcatacaacacaccttaac4320
    .............................. lac_pro....................
    ............................................................
    4321tgagcggataacaatttcacacaggaaacagctatgaccatgattacgccaagctgtaag4380
    4321actcgcctattgttaaagtgtgtcctttgtcgatactggtactaatgcggttcgacattc4380
    .............................. M13r_pri....................
    ............................................................
    4381tttaaacatgatcttactaactaactattctcatttaaattttcagagcttaaaaatggc4440
    4381aaatttgtactagaatgattgattgataagagtaaatttaaaagtctcgaatttttaccg4440
    .................... decoy..............................
    ............................................................
    4441tgaaatcactcacaacgatggatacgctaacaacttggaaatgaaat.............4487
    4441actttagtgagtgttgctacctatgcgattgttgaacctttacttta.............4487
    ............................................................

    References



  • Copyright 2005 BVTech, Inc. All Rights Reserved