Download the plasmid map Use BVTech Plasmid to view and edit this plasmid map. Dowload BVTech Plasmid If you do not have BVTech Plasmid, download the latest version of BVTech Plasmid here. BVTech Plasmid is DNA sequence analysis and plasmid drawing software for Windows PCs. You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your DNA sequencing data, align sequences, and much more. Free to try, $39.98 to buy Payments will be processed by PayPal. PayPal is the safer, easier way to pay.

View the sequence with features on line
pQLinkH
Gene/insert name: multi cloning site
Alternative names: pQTEV3
Insert size (bp): 28
GenBank/Entrez ID of insert: EF025688
Fusion proteins or tags: His
Terminal: N terminal on backbone
Fusion proteins or tags: attB1
Terminal: N terminal on backbone
Fusion proteins or tags: TEV
Terminal: N terminal on backbone
Vector backbone: pQE-2
Backbone manufacturer: Qiagen
Type of vector: Bacterial expression,Co-expression
Backbone size (bp): 4873
Cloning site 5': BamHI
Site destroyed during cloning: No
Cloning site 3': NotI
Site destroyed during cloning: No
5' Sequencing primer: pQE65, TGAGCGGATAACAATTTCACACAG
3' Sequencing primer: pQE276, GGCAACCGAGCGTTCTGAAC
Bacteria resistance: Ampicillin
High or low copy: Don't Know
Grow in standard E. coli @ 37C: Yes
Plasmid Provided In: DH5a
Principal Investigator: Konrad Buessow
Article: Vectors for co-expression of an unrestricted number of proteins. Scheich C et al. (Nucleic Acids Res. 2007 Feb 20. ():. Pubmed)