|
Gene/insert name: multi cloning site
Alternative names: pQTEV3
Insert size (bp): 28
GenBank/Entrez ID of insert: EF025688
Fusion proteins or tags: His
Terminal: N terminal on backbone
Fusion proteins or tags: attB1
Terminal: N terminal on backbone
Fusion proteins or tags: TEV
Terminal: N terminal on backbone
Vector backbone: pQE-2
Backbone manufacturer: Qiagen
Type of vector: Bacterial expression,Co-expression
Backbone size (bp): 4873
Cloning site 5': BamHI
Site destroyed during cloning: No
Cloning site 3': NotI
Site destroyed during cloning: No
5' Sequencing primer: pQE65, TGAGCGGATAACAATTTCACACAG
3' Sequencing primer: pQE276, GGCAACCGAGCGTTCTGAAC
Bacteria resistance: Ampicillin
High or low copy: Don't Know
Grow in standard E. coli @ 37C: Yes
Plasmid Provided In: DH5a
Principal Investigator: Konrad Buessow
Article: Vectors for co-expression of an unrestricted number of proteins. Scheich C et al. (Nucleic Acids Res. 2007 Feb 20. ():. Pubmed)
Download plasmid map
Copyright 2005 BVTech, Inc. All Rights Reserved
|