Download the plasmid map Use BVTech Plasmid to view and edit this plasmid map. Dowload BVTech Plasmid If you do not have BVTech Plasmid, download the latest version of BVTech Plasmid here. BVTech Plasmid is DNA sequence analysis and plasmid drawing software for Windows PCs. You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your DNA sequencing data, align sequences, and much more. Free to try, $39.98 to buy Payments will be processed by PayPal. PayPal is the safer, easier way to pay.

View the sequence with features on line
pQLinkHD
Gene/insert name: Gateway cassette
Alternative names: pDESTco
Insert size (bp): 2342
GenBank/Entrez ID of insert: EF025686
Fusion proteins or tags: His
Terminal: N terminal on backbone
Vector backbone: pQE-2
Backbone manufacturer: Qiagen
Type of vector: Bacterial expression,Co-Expression
Backbone size (bp): 7062
Cloning site 5': attR1
Site destroyed during cloning: Yes
Cloning site 3': attR2
Site destroyed during cloning: Yes
5' Sequencing primer: pQE65, TGAGCGGATAACAATTTCACACAG
3' Sequencing primer: pQE276, GGCAACCGAGCGTTCTGAAC
Bacteria resistance: Ampicillin
High or low copy: Don't Know
Grow in standard E. coli @ 37C: No
Please specify bacterial strain for growth and growth condition: DB3.1 from Invitrogen
Plasmid Provided In: DB3.1
Principal Investigator: Konrad Buessow
Article: Vectors for co-expression of an unrestricted number of proteins. Scheich C et al. (Nucleic Acids Res. 2007 Feb 20. ():. Pubmed)