BV Tech Plasmid
Plasmid drawing software

Plasmid map of pQLinkHD

Gene/insert name: Gateway cassette
Alternative names: pDESTco
Insert size (bp): 2342
GenBank/Entrez ID of insert: EF025686
Fusion proteins or tags: His
Terminal: N terminal on backbone
Vector backbone: pQE-2
Backbone manufacturer: Qiagen
Type of vector: Bacterial expression,Co-Expression
Backbone size (bp): 7062
Cloning site 5': attR1
Site destroyed during cloning: Yes
Cloning site 3': attR2
Site destroyed during cloning: Yes
5' Sequencing primer: pQE65, TGAGCGGATAACAATTTCACACAG
3' Sequencing primer: pQE276, GGCAACCGAGCGTTCTGAAC
Bacteria resistance: Ampicillin
High or low copy: Don't Know
Grow in standard E. coli @ 37C: No
Please specify bacterial strain for growth and growth condition: DB3.1 from Invitrogen
Plasmid Provided In: DB3.1
Principal Investigator: Konrad Buessow
Article: Vectors for co-expression of an unrestricted number of proteins. Scheich C et al. (Nucleic Acids Res. 2007 Feb 20. ():. Pubmed)

Download plasmid map



image of the Plasmid



Copyright 2005 BVTech, Inc. All Rights Reserved

Search
Google
Web biovisualtech.com
Free Software Downloads
BVTech Photo Publisher
Help you publish your pictures over the Internet or a local network so that other people can view them in their Web browsers
HealthWatch
A virtual apple a day to keep the doctor away
Download VisualSniffer 2.0
VisualSniffer is a powerful packet capture tool and protocol analyzer
BVTech Plasmid
A plasmid drawing software


Download Growth Chart SDK to integrate the functionality of Growth Charts from HealthWatch Pro into your business applications