|
Gene/insert name: Gateway cassette
Alternative names: pDESTco
Insert size (bp): 2342
GenBank/Entrez ID of insert: EF025686
Fusion proteins or tags: His
Terminal: N terminal on backbone
Vector backbone: pQE-2
Backbone manufacturer: Qiagen
Type of vector: Bacterial expression,Co-Expression
Backbone size (bp): 7062
Cloning site 5': attR1
Site destroyed during cloning: Yes
Cloning site 3': attR2
Site destroyed during cloning: Yes
5' Sequencing primer: pQE65, TGAGCGGATAACAATTTCACACAG 3' Sequencing primer: pQE276, GGCAACCGAGCGTTCTGAAC
Bacteria resistance: Ampicillin
High or low copy: Don't Know
Grow in standard E. coli @ 37C: No
Please specify bacterial strain for growth and growth condition: DB3.1 from Invitrogen
Plasmid Provided In: DB3.1
Principal Investigator: Konrad Buessow Article: Vectors for co-expression of an unrestricted number of proteins. Scheich C et al. (Nucleic Acids Res. 2007 Feb 20. ():. Pubmed)
Download plasmid map
Copyright 2005 BVTech, Inc. All Rights Reserved
|