image of the BVTech Plasmid
Search plasmid maps in this site
Google
Web biovisualtech.com
More Plasmid Map Templates
  • Adenoviral
  • Bacterial expression
  • Cre/Lox
  • Insect expression
  • Lentiviral
  • Luciferase
  • Mammalian expression
  • Other
  • Retroviral
  • RNAi
  • Worm expression
  • Yeast expression
  • Bacterial vectors
  • Mammalian
  • Recent Release from EMBL
  • Free Software Downloads
    BVTech Photo Publisher
    Help you publish your pictures over the Internet or a local network so that other people can view them in their Web browsers
    HealthWatch
    A virtual apple a day to keep the doctor away
    Download VisualSniffer 2.0
    VisualSniffer is a powerful packet capture tool and protocol analyzer
    BVTech Plasmid
    A plasmid drawing software
    Download Growth Chart SDK to integrate the functionality of Growth Charts from HealthWatch Pro into your business applications

    Plasmid map of pQLinkHD

    Download the plasmid map
    Use BVTech Plasmid to view and edit this plasmid map.

    Dowload BVTech Plasmid
    If you do not have BVTech Plasmid, download the latest version of BVTech Plasmid here.

    BVTech Plasmid is DNA sequence analysis and plasmid drawing software for Windows PCs. You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your DNA sequencing data, align sequences, and much more.

    Free to try, $39.98 to buy

    Payments will be processed by PayPal. PayPal is the safer, easier way to pay.

    View the sequence with features on line
    pQLinkHD
    Gene/insert name: Gateway cassette
    Alternative names: pDESTco
    Insert size (bp): 2342
    GenBank/Entrez ID of insert: EF025686
    Fusion proteins or tags: His
    Terminal: N terminal on backbone
    Vector backbone: pQE-2
    Backbone manufacturer: Qiagen
    Type of vector: Bacterial expression,Co-Expression
    Backbone size (bp): 7062
    Cloning site 5': attR1
    Site destroyed during cloning: Yes
    Cloning site 3': attR2
    Site destroyed during cloning: Yes
    5' Sequencing primer: pQE65, TGAGCGGATAACAATTTCACACAG
    3' Sequencing primer: pQE276, GGCAACCGAGCGTTCTGAAC
    Bacteria resistance: Ampicillin
    High or low copy: Don't Know
    Grow in standard E. coli @ 37C: No
    Please specify bacterial strain for growth and growth condition: DB3.1 from Invitrogen
    Plasmid Provided In: DB3.1
    Principal Investigator: Konrad Buessow
    Article: Vectors for co-expression of an unrestricted number of proteins. Scheich C et al. (Nucleic Acids Res. 2007 Feb 20. ():. Pubmed)



    image of pQLinkHD



    Copyright 2005 BVTech, Inc. All Rights Reserved