image of the BVTech Plasmid
Search plasmid maps in this site
More Plasmid Map Templates
  • Adenoviral
  • Bacterial expression
  • Cre/Lox
  • Insect expression
  • Lentiviral
  • Luciferase
  • Mammalian expression
  • Other
  • Retroviral
  • RNAi
  • Worm expression
  • Yeast expression
  • Bacterial vectors
  • Mammalian
  • Recent Release from EMBL
  • Free Software Downloads
    BVTech Photo Publisher
    Help you publish your pictures over the Internet or a local network so that other people can view them in their Web browsers
    A virtual apple a day to keep the doctor away
    Download VisualSniffer 2.0
    VisualSniffer is a powerful packet capture tool and protocol analyzer
    BVTech Plasmid
    A plasmid drawing software
    Download Growth Chart SDK to integrate the functionality of Growth Charts from HealthWatch Pro into your business applications

    Plasmid map of pShuttle-CMV-EGFP-C

    Download the plasmid map
    Use BVTech Plasmid to view and edit this plasmid map.

    Dowload BVTech Plasmid
    If you do not have BVTech Plasmid, download the latest version of BVTech Plasmid here.

    BVTech Plasmid is DNA sequence analysis and plasmid drawing software for Windows PCs. You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your DNA sequencing data, align sequences, and much more.

    Free to try, $39.98 to buy

    Payments will be processed by PayPal. PayPal is the safer, easier way to pay.

    View the sequence with features on line
    Gene/insert name: C domain of N-WASP
    Alternative names: EGFP-C
    Insert size (bp): 789
    GenBank/Entrez ID of insert: NM_174219
    Gene/insert aliases: WASL, WASL
    Species of gene(s): B. taurus (bovine)
    Relevant mutations/deletions: The BglII site in the MCS of pShuttle-CMV was filled and the vector was religated in order to remove this BglII site.
    Fusion proteins or tags: EGFP
    Terminal: N terminal on insert
    Vector backbone: pShuttle-CMV (Search Vector Database)
    Backbone manufacturer: Stratagene
    Type of vector: Adenoviral
    Backbone size (bp): 7500
    Cloning site 5': NotI
    Site destroyed during cloning: No
    Cloning site 3': HinDIII
    Site destroyed during cloning: No
    5' Sequencing primer: GGCACCAAAATCAACGGGACTTTC C (List of Sequencing Primers)
    Bacteria resistance: Kanamycin
    High or low copy: Low Copy
    Grow in standard E. coli @ 37C: Yes
    If you did not originally clone this gene, from whom and where did you receive the plasmid used to derive this plasmid: The original full length N-WASP gene clone was given to me by Dr. Laura Machesky School of Biosciences The University of Birmingham Edgbaston Birmingham B15 2TT UK
    Plasmid Provided In: DH5a
    Principal Investigator: Lorene Lanier
    Article: Arp2/3 is a negative regulator of growth cone translocation. Strasser GA et al. (Neuron. 2004 Jul 8. 43(1):81-94. Pubmed)

    image of pShuttle-CMV-EGFP-C

    Copyright 2005 BVTech, Inc. All Rights Reserved