image of the BVTech Plasmid
Search plasmid maps in this site
Google
Web biovisualtech.com
More Plasmid Map Templates
  • Adenoviral
  • Bacterial expression
  • Cre/Lox
  • Insect expression
  • Lentiviral
  • Luciferase
  • Mammalian expression
  • Other
  • Retroviral
  • RNAi
  • Worm expression
  • Yeast expression
  • Bacterial vectors
  • Mammalian
  • Recent Release from EMBL
  • BVTech Plasmid

    This sequnce graph is created using BVTech Plasmid, which is DNA sequence analysis and plasmid drawing software for Windows PCs.You can use it to plan your DNA cloning, draw high quality plasmid maps, analyse your DNA sequencing data, align sequences, and much more.

    Free to try, $39.98 to buy

    Payments will be processed by PayPal. PayPal is the safer, easier way to pay.

    Sequence of pcDNA3.1(-)

  • Download the sequence and plasmid map, and then use BVTech Plasmid to view and edit the file.
  • If you do not have BVTech Plasmid, download the latest version of BVTech Plasmid here.
  • View the plasmid map on line

    Sequence of pcDNA3.1(-) : 5427 BP; 1253 A; 1414 C; 1382 G; 1378 T; 0 other;

    .......... BglII(12)........................................
    1gacggatcgggagatctcccgatcccctatggtgcactctcagtacaatctgctctgatg60
    1ctgcctagccctctagagggctaggggataccacgtgagagtcatgttagacgagactac60
    ............................................................
    ............................................................
    61ccgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagtagtgcg120
    61ggcgtatcaattcggtcatagacgagggacgaacacacaacctccagcgactcatcacgc120
    ............................................................
    ............................................................
    121cgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaatctgc180
    121gctcgttttaaattcgatgttgttccgttccgaactggctgttaacgtacttcttagacg180
    ............................................................
    .................... NruI(208)..............................
    181ttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttgacatt240
    181aatcccaatccgcaaaacgcgacgaagcgctacatgcccggtctatatgcgcaactgtaa240
    ............................................................
    ............................................................
    241gattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatata300
    241ctaataactgatcaataattatcattagttaatgccccagtaatcaagtatcgggtatat300
    ................. CMV_immearly_pro...........................
    ............................................................
    301tggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacc360
    301acctcaaggcgcaatgtattgaatgccatttaccgggcggaccgactggcgggttgctgg360
    ................. CMV_immearly_pro CAG_enh.................
    ............................................................
    361cccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaata gggactttcc420
    361gggcgggtaactgcagttattactgcatacaagggtatcattgcggttatccctgaaagg420
    ............. CAG_enh CMV_immearly_pro.......................
    ............................................................
    421attgacgtcaatgggtggagtatttacggtaaactgcccacttggcagta catcaagtgt480
    421taactgcagttacccacctcataaatgccatttgacgggtgaaccgtcatgtagttcaca480
    ............. CAG_enh CMV_immearly_pro.......................
    NdeI(484)..................................................
    481atcatatgccaagtacgccccctattgacgtcaatgacggtaaatggccc gcctggcatt540
    481tagtatacggttcatgcgggggataactgcagttactgccatttaccgggcggaccgtaa540
    ............. CAG_enh CMV_immearly_pro.......................
    ............................................................
    541atgcccagtacatgaccttatgggactttcctacttggcagtacatctac gtattagtca600
    541tacgggtcatgtactggaataccctgaaaggatgaaccgtcatgtagatgcataatcagt600
    ............. CAG_enh CMV_immearly_pro.......................
    ............................................................
    601tcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttg660
    601agcgataatggtaccactacgccaaaaccgtcatgtagttacccgcacctatcgccaaac660
    ................. CMV_immearly_pro...........................
    ............................................................
    661actcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcacc720
    661tgagtgcccctaaaggttcagaggtggggtaactgcagttaccctcaaacaaaaccgtgg720
    ................. CMV_immearly_pro...........................
    ............................................................
    721aaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcg780
    721ttttagttgccctgaaaggttttacagcattgttgaggcggggtaactgcgtttacccgc780
    ................. CMV_immearly_pro................ CMV_fwd_pri
    ............................................................
    781gtaggcgtgtacggtgggaggtctatataagcagagctctctggctaactagagaaccca840
    781catccgcacatgccaccctccagatatattcgtctcgagagaccgattgatctcttgggt840
    CMV_fwd_pri..... CMV_immearly_pro...........................
    ............................................................
    841ctgcttactggcttatcgaaattaatacgactcactatagggagacccaagctggctagc900
    841gacgaatgaccgaatagctttaattatgctgagtgatatccctctgggttcgaccgatcg900
    CMV_immearly_pro.............. T7_pro....................
    ApaI913),XbaI(915) XhoI(921) NotI(927) EcoRV(946)..........
    901gtttaaacgggccctctagactcgagcggccgccactgtgctggatatctgcagaattcc960
    901caaatttgcccgggagatctgagctcgccggcggtgacacgacctatagacgtcttaagg960
    ............................................................
    ........ BamHI(977) KpnI(993),HindIII(995),AflII(998)........
    961accacactggactagtggatccgagctcggtaccaagcttaagtttaaaccgctgatcag1020
    961tggtgtgacctgatcacctaggctcgagccatggttcgaattcaaatttggcgactagtc1020
    ............................................................
    ............................................................
    1021cctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttcct1080
    1021ggagctgacacggaagatcaacggtcggtagacaacaaacggggagggggcacggaagga1080
    BGH_rev_pri................. bGH_PA_term...................
    ............................................................
    1081tgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgc1140
    1081actgggaccttccacggtgagggtgacaggaaaggattattttactcctttaacgtagcg1140
    ................... bGH_PA_term.............................
    ............................................................
    1141attgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaaggggg1200
    1141taacagactcatccacagtaagataagaccccccaccccaccccgtcctgtcgttccccc1200
    ................... bGH_PA_term.............................
    ............................................................
    1201aggattgggaagacaatagcaggcatgctggggatgcggtgggctctatggcttctgagg1260
    1201tcctaacccttctgttatcgtccgtacgacccctacgccacccgagataccgaagactcc1260
    ................... bGH_PA_term.............................
    ............................................................
    1261cggaaagaaccagctggggctctagggggtatccccacgcgccctgtagcggcgcattaa1320
    1261gcctttcttggtcgaccccgagatcccccataggggtgcgcgggacatcgccgcgtaatt1320
    ............................................................
    ............................................................
    1321gcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgc1380
    1321cgcgccgcccacaccaccaatgcgcgtcgcactggcgatgtgaacggtcgcgggatcgcg1380
    .................... f1_origin..............................
    ............................................................
    1381ccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaag1440
    1381ggcgaggaaagcgaaagaagggaaggaaagagcggtgcaagcggccgaaaggggcagttc1440
    .................... f1_origin..............................
    ............................................................
    1441ctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgacccca1500
    1441gagatttagcccccgagggaaatcccaaggctaaatcacgaaatgccgtggagctggggt1500
    .................... f1_origin..............................
    ............................................................
    1501aaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttc1560
    1501tttttgaactaatcccactaccaagtgcatcacccggtagcgggactatctgccaaaaag1560
    .................... f1_origin..............................
    ............................................................
    1561gccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaa1620
    1561cgggaaactgcaacctcaggtgcaagaaattatcacctgagaacaaggtttgaccttgtt1620
    .................... f1_origin..............................
    ............................................................
    1621cactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcct1680
    1621gtgagttgggatagagccagataagaaaactaaatattccctaaaacggctaaagccgga1680
    ............................................................
    ............................................................
    1681attggttaaaaaatgagctgatttaacaaaaatttaacgcgaattaattctgtggaatgt1740
    1681taaccaattttttactcgactaaattgtttttaaattgcgcttaattaagacaccttaca1740
    ............................................................
    ............................................................
    1741gtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcat1800
    1741cacagtcaatcccacacctttcaggggtccgaggggtcgtccgtcttcatacgtttcgta1800
    pBABE_3_pri........ SV40_enh SV40_pro....................
    ............................................................
    1801gcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaag1860
    1801cgtagagttaatcagtcgttggtccacacctttcaggggtccgaggggtcgtccgtcttc1860
    ................ SV40_enh SV40_pro..........................
    ............................................................
    1861tatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccat1920
    1861atacgtttcgtacgtagagttaatcagtcgttggtatcagggcggggattgaggcgggta1920
    ................ SV40_enh SV40_pro..........................
    ............................................................
    1921cccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttt1980
    1921gggcggggattgaggcgggtcaaggcgggtaagaggcggggtaccgactgattaaaaaaa1980
    ..... SV40_enh SV40_pro SV40_origin.........................
    ............................................................
    1981tatttatgcagaggccgaggccgcctctgcctctgagctattccagaagtagtgaggagg2040
    1981ataaatacgtctccggctccggcggagacggagactcgataaggtcttcatcactcctcc2040
    SV40_origin SV40pro_F_pri SV40_pro........................
    .......... StuI(2052).......... SmaI(2076)....................
    2041cttttttggaggcctaggcttttgcaaaaagctcccgggagcttgtatatccattttcgg2100
    2041gaaaaaacctccggatccgaaaacgtttttcgagggccctcgaacatataggtaaaagcc2100
    ............................................................
    ............................................................
    2101atctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgc2160
    2101tagactagttctctgtcctactcctagcaaagcgtactaacttgttctacctaacgtgcg2160
    ...................................... ORF 2 Neomycin........
    ............................................................
    2161aggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaat2220
    2161tccaagaggccggcgaacccacctctccgataagccgatactgacccgtgttgtctgtta2220
    .................. ORF 2 Neomycin............................
    ............................................................
    2221cggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgt2280
    2221gccgacgagactacggcggcacaaggccgacagtcgcgtccccgcgggccaagaaaaaca2280
    .................. ORF 2 Neomycin............................
    ............................................................
    2281caagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtg2340
    2281gttctggctggacaggccacgggacttacttgacgtcctgctccgtcgcgccgatagcac2340
    .................. ORF 2 Neomycin............................
    MscI(2345)..................................................
    2341gctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaag2400
    2341cgaccggtgctgcccgcaaggaacgcgtcgacacgagctgcaacagtgacttcgcccttc2400
    .................. ORF 2 Neomycin............................
    ............................................................
    2401ggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcc2460
    2401cctgaccgacgataacccgcttcacggccccgtcctagaggacagtagagtggaacgagg2460
    .................. ORF 2 Neomycin............................
    ............................................................
    2461tgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggc2520
    2461acggctctttcataggtagtaccgactacgttacgccgccgacgtatgcgaactaggccg2520
    .................. ORF 2 Neomycin............................
    ............................................................
    2521tacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatgga2580
    2521atggacgggtaagctggtggttcgctttgtagcgtagctcgctcgtgcatgagcctacct2580
    .................. ORF 2 Neomycin............................
    ............................................................
    2581agccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccga2640
    2581tcggccagaacagctagtcctactagacctgcttctcgtagtccccgagcgcggtcggct2640
    .................. ORF 2 Neomycin............................
    ............................................................
    2641actgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatgg2700
    2641tgacaagcggtccgagttccgcgcgtacgggctgccgctcctagagcagcactgggtacc2700
    .................. ORF 2 Neomycin............................
    ............................................................
    2701cgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactg2760
    2701gctacggacgaacggcttatagtaccaccttttaccggcgaaaagacctaagtagctgac2760
    .................. ORF 2 Neomycin............................
    ............................................................
    2761tggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgc2820
    2761accggccgacccacaccgcctggcgatagtcctgtatcgcaaccgatgggcactataacg2820
    .................. ORF 2 Neomycin............................
    ............................................................
    2821tgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcc2880
    2821acttctcgaaccgccgcttacccgactggcgaaggagcacgaaatgccatagcggcgagg2880
    .................. ORF 2 Neomycin............................
    ............................................................
    2881cgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgagcgggactctg2940
    2881gctaagcgtcgcgtagcggaagatagcggaagaactgctcaagaagactcgccctgagac2940
    .................. ORF 2 Neomycin............................
    BstBI(2945)................................................
    2941gggttcgaaatgaccgaccaagcgacgcccaacctgccatcacgagatttcgattccacc3000
    2941cccaagctttactggctggttcgctgcgggttggacggtagtgctctaaagctaaggtgg3000
    ............................................................
    ............................................................
    3001gccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccggctggatgatc3060
    3001cggcggaagatactttccaacccgaagccttagcaaaaggccctgcggccgacctactag3060
    ............................................................
    ............................................................
    3061ctccagcgcggggatctcatgctggagttcttcgcccaccccaacttgtttattgcagct3120
    3061gaggtcgcgcccctagagtacgacctcaagaagcgggtggggttgaacaaataacgtcga3120
    ................................................. SV40_PA_term
    ............................................................
    3121tataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttca3180
    3121atattaccaatgtttatttcgttatcgtagtgtttaaagtgtttatttcgtaaaaaaagt3180
    ................... SV40_PA_term.............................
    ............................................................
    3181ctgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctgtataccg3240
    3181gacgtaagatcaacaccaaacaggtttgagtagttacatagaatagtacagacatatggc3240
    ............. SV40_PA_term EBV_rev_pri.......................
    ............................................................
    3241tcgacctctagctagagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgt3300
    3241agctggagatcgatctcgaaccgcattagtaccagtatcgacaaaggacacactttaaca3300
    ........................... M13_reverse_pri.... M13_pUC_rev_pri
    ............................................................
    3301tatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggt3360
    3301ataggcgagtgttaaggtgtgttgtatgctcggccttcgtatttcacatttcggacccca3360
    .............................. lac_pro....................
    ............................................................
    3361gcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcg3420
    3361cggattactcactcgattgagtgtaattaacgcaacgcgagtgacgggcgaaaggtcagc3420
    ............................................................
    ............................................................
    3421ggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttg3480
    3421cctttggacagcacggtcgacgtaattacttagccggttgcgcgcccctctccgccaaac3480
    ............................................................
    ............................................................
    3481cgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctg3540
    3481gcataacccgcgagaaggcgaaggagcgagtgactgagcgacgcgagccagcaagccgac3540
    ............................................................
    ............................................................
    3541cggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggat3600
    3541gccgctcgccatagtcgagtgagtttccgccattatgccaataggtgtcttagtccccta3600
    ............................................................
    ............................................................
    3601aacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggcc3660
    3601ttgcgtcctttcttgtacactcgttttccggtcgttttccggtccttggcatttttccgg3660
    ............................................................
    ............................................................
    3661gcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgc3720
    3661cgcaacgaccgcaaaaaggtatccgaggcggggggactgctcgtagtgtttttagctgcg3720
    .................. pBR322_origin............................
    ............................................................
    3721tcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctgga3780
    3721agttcagtctccaccgctttgggctgtcctgatatttctatggtccgcaaagggggacct3780
    .................. pBR322_origin............................
    ............................................................
    3781agctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgccttt3840
    3781tcgagggagcacgcgagaggacaaggctgggacggcgaatggcctatggacaggcggaaa3840
    .................. pBR322_origin............................
    ............................................................
    3841ctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtg3900
    3841gagggaagcccttcgcaccgcgaaagagtatcgagtgcgacatccatagagtcaagccac3900
    .................. pBR322_origin............................
    ............................................................
    3901taggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgc3960
    3901atccagcaagcgaggttcgacccgacacacgtgcttggggggcaagtcgggctggcgacg3960
    .................. pBR322_origin............................
    ............................................................
    3961gccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactg4020
    3961cggaataggccattgatagcagaactcaggttgggccattctgtgctgaatagcggtgac4020
    .................. pBR322_origin............................
    ............................................................
    4021gcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttc4080
    4021cgtcgtcggtgaccattgtcctaatcgtctcgctccatacatccgccacgatgtctcaag4080
    .................. pBR322_origin............................
    ............................................................
    4081ttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctg4140
    4081aacttcaccaccggattgatgccgatgtgatcttcttgtcataaaccatagacgcgagac4140
    .................. pBR322_origin............................
    ............................................................
    4141ctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccacc4200
    4141gacttcggtcaatggaagcctttttctcaaccatcgagaactaggccgtttgtttggtgg4200
    .................. pBR322_origin............................
    ............................................................
    4201gctggtagcggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaa4260
    4201cgaccatcgccaaaaaaacaaacgttcgtcgtctaatgcgcgtctttttttcctagagtt4260
    .................. pBR322_origin............................
    ............................................................
    4261gaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaa4320
    4261cttctaggaaactagaaaagatgccccagactgcgagtcaccttgcttttgagtgcaatt4320
    pBR322_origin..............................................
    ............................................................
    4321gggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaa4380
    4321ccctaaaaccagtactctaatagtttttcctagaagtggatctaggaaaatttaattttt4380
    ............................................................
    ............................................................
    4381tgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgc4440
    4381acttcaaaatttagttagatttcatatatactcatttgaaccagactgtcaatggttacg4440
    ............................................... ORF 3 Ampicillin
    ............................................................
    4441ttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctga4500
    4441aattagtcactccgtggatagagtcgctagacagataaagcaagtaggtatcaacggact4500
    ................. ORF 3 Ampicillin...........................
    ............................................................
    4501ctccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgca4560
    4501gaggggcagcacatctattgatgctatgccctcccgaatggtagaccggggtcacgacgt4560
    ................. ORF 3 Ampicillin...........................
    ............................................................
    4561atgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagcc4620
    4561tactatggcgctctgggtgcgagtggccgaggtctaaatagtcgttatttggtcggtcgg4620
    ................. ORF 3 Ampicillin...........................
    ............................................................
    4621ggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaat4680
    4621ccttcccggctcgcgtcttcaccaggacgttgaaataggcggaggtaggtcagataatta4680
    ................. ORF 3 Ampicillin...........................
    ............................................................
    4681tgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgcc4740
    4681acaacggcccttcgatctcattcatcaagcggtcaattatcaaacgcgttgcaacaacgg4740
    ................. ORF 3 Ampicillin...........................
    ............................................................
    4741attgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggt4800
    4741taacgatgtccgtagcaccacagtgcgagcagcaaaccataccgaagtaagtcgaggcca4800
    ................. ORF 3 Ampicillin...........................
    ............................................................
    4801tcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctcc4860
    4801agggttgctagttccgctcaatgtactagggggtacaacacgttttttcgccaatcgagg4860
    ................. ORF 3 Ampicillin...........................
    ............................................................
    4861ttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatg4920
    4861aagccaggaggctagcaacagtcttcattcaaccggcgtcacaatagtgagtaccaatac4920
    ................. ORF 3 Ampicillin...........................
    ............................................................
    4921gcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggt4980
    4921cgtcgtgacgtattaagagaatgacagtacggtaggcattctacgaaaagacactgacca4980
    ................. ORF 3 Ampicillin...........................
    ............................................................
    4981gagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccg5040
    4981ctcatgagttggttcagtaagactcttatcacatacgccgctggctcaacgagaacgggc5040
    ................. ORF 3 Ampicillin...........................
    ............................................................
    5041gcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattgga5100
    5041cgcagttatgccctattatggcgcggtgtatcgtcttgaaattttcacgagtagtaacct5100
    ................. ORF 3 Ampicillin...........................
    ............................................................
    5101aaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatg5160
    5101tttgcaagaagccccgcttttgagagttcctagaatggcgacaactctaggtcaagctac5160
    ................. ORF 3 Ampicillin...........................
    ............................................................
    5161taacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctggg5220
    5161attgggtgagcacgtgggttgactagaagtcgtagaaaatgaaagtggtcgcaaagaccc5220
    ................. ORF 3 Ampicillin...........................
    ............................................................
    5221tgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgt5280
    5221actcgtttttgtccttccgttttacggcgttttttcccttattcccgctgtgcctttaca5280
    ................. ORF 3 Ampicillin...........................
    ............................................................
    5281tgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctc5340
    5281acttatgagtatgagaaggaaaaagttataataacttcgtaaatagtcccaataacagag5340
    ORF 3 Ampicillin............................................
    ............................................................
    5341atgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcaca5400
    5341tactcgcctatgtataaacttacataaatctttttatttgtttatccccaaggcgcgtgt5400
    .......... AmpR_pro........................................
    ............................................................
    5401tttccccgaaaagtgccacctgacgtc.................................5427
    5401aaaggggcttttcacggtggactgcag.................................5427
    ............................................................

    References



  • Copyright 2005 BVTech, Inc. All Rights Reserved