BV Tech Plasmid
Plasmid drawing software

Plasmid map of pcDNA31-His-A

Vector Backbone: pcDNA3.1/His A
Vendor: Invitrogen
Alternate Vector Names: pcDNA 3.1 His A
Vector Type: Mammalian
Viral/Non-viral: Nonviral
Stable/Transient: Transient
Constitutive/Inducible: Constitutive
Promoter: CMV
Expression Level: High
Backbone Size (bp): 5514
Sequencing Primer: T7 Fwd
Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'
Tag: His
Bacteria Resistance: Ampicillin
Mammalian Selection: neomycin
Catalog Number: V38520

Download plasmid map



image of the Plasmid



Copyright 2005 BVTech, Inc. All Rights Reserved

Search
Google
Web biovisualtech.com
Free Software Downloads
BVTech Photo Publisher
Help you publish your pictures over the Internet or a local network so that other people can view them in their Web browsers
HealthWatch
A virtual apple a day to keep the doctor away
Download VisualSniffer 2.0
VisualSniffer is a powerful packet capture tool and protocol analyzer
BVTech Plasmid
A plasmid drawing software


Download Growth Chart SDK to integrate the functionality of Growth Charts from HealthWatch Pro into your business applications